ORFeome > nfkbia – XORFeome 2.0

nfkbia – XORFeome 2.0

General Information

Species: Xenopus tropicalis nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha, mRNA (cDNA clone MGC:69359 IMAGE:5309348), complete cds
Gene Symbol: nfkbia
Gene ID: 448138
ORF gb_acc: MG133326
ORF ID: 10826

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC074672

Library Location

Plate ID: GDExt11007
Well Location: A08

EST Sequences

Clone: MGC:69359 IMAGE:5309348
Trimmed Sequence: ATGTCTGTGCCTTTTCACGATTACCAAGGGAATATGATGGAGGGAGAAGCTAGGGATCTCCGGAAGGACAAACTGCTGCAGGACGATCGCATTGATAGCGGCCTGGACTCCCTGAAGGAGGAGGAATACACGGCTATCATTACTGACCTCAGCAACATGAGAATGGAGGGCCCGCCGGACACATCGAACTATGAGCCGGAGCCATGGAAGAAAGAGGTCAACGAAGATGGAGACACGTTTCTCCATTTGGCAATTATCCATGAAGAGAAAACCCTGGTGAAGGAGGCAATCCAACGTTCATACAGGGACCATTTTTACCTGAACAAGCAGAATAATCTGCACCAGACAGCACTACATCTGGCAGTAATCACCGAACAACAAGACATCAGCCAGTCACTTCTCCAGGCTGGTTGTGATCCAGAAATCCAAGACTTCTGTGGCAACACCGCCTTGCACATTGCCTGCAAGCAGGGCTCGCTTCGGGGAGTTGGGGTCATTTTCCAGTATTGTGAGAAACAACTGCCAGCACTTCTGCAATCTGTGAACTATGATGGTCACACGTGCCTCCACCTGGCATCGATCCATGGCTATCTTGCAATTGTGGAAAATCTCATTAATAAGGGGGCTGATATAAATGCCCAGGAGCCTTGCAATGGTCGCACTGTGCTGCATATGGCCGTGGACCTGCAGAACTACGACCTGATGAAACTGCTGCTTAAGCACGGAGCAGATGTAAACAGAGTCACGTACCAAGGCTACTCTCCGTGCCAGCTCACATGGGGCAGAAATAACATGCTGATTCAACAACAGCTGGTTGAAGTGACACACAAGAATTTGCAGTACCTTCCAGAGAGTGAAGAGGAAGACAGTTCTGACTCCGAATATGAATATAATGATGATGAGCTTATGTATGACGACTGCATCATAGGGGGGAGGCCGCTGCATTAG
Full Trace Sequence: ctctgatcggatgggattagtatagaggaggctacagctacagaacttcactatcgcaactgggattctacagtgtcttctaagctattttgcggggaagctcaacaaccggccgccgccatgtctgtgccttttcacgattaccaagggaatatgatggagggagaagctagggatctccggaaggacaaactgctgcaggacgatcgcattgatagcggcctggactccctgaaggaggaggaatacacggctatcattactgacctcagcaacatgagaatggagggcccgccggacacatcgaactatgagccggagccatggaagaaagaggtcaacgaagatggagacacgtttctccatttggcaattatccatgaagagaaaaccctggtgaaggaggcaatccaacgttcatacagggaccatttttacctgaacaagcagaataatctgcaccagacagcactacatctggcagtaatcaccgaacaacaagacatcagccagtcacttctccaggctggttgtgatccagaaatccaagacttctgtggcaacaccgccttgcacattgcctgcaagcagggctcgcttcggggagttggggtcattttccagtattgtgagaaacaactgccagcacttctgcaatctgtgaactatgatggtcacacgtgcctccacctggcatcgatccatggctatcttgcaattgtggaaaatctcattaataagggggctgatataaatgcccaggagccttgcaatggtcgcactgtgctgcatatggccgtggacctgcagaactacgacctgatgaaactgctgcttaagcacggagcagatgtaaacagagtcacgtaccaaggctactctccgtgccagctcacatggggcagaaataacatgctgattcaacaacagctggttgaagtgacacacaagaatttgcagtaccttccagagagtgaagaggaagacagttctgactccgaatatgaatataatgatgatgagcttatgtatgacgactgcatcataggggggaggccgctgcattagactgctgtgtgtgaactaaaaaaaagaaactataaggacagactctcattactagaggacagcactggagccagtgacttcggggtagaaaaggatcctctgaaagttgaggcgtggaggtgcttgtgctgttccatggtgaccgatgttctacacgagaagcttcctgtgttacatatcctgccgcatcaagaccacagctatgaattaaagagcttattccttgagcagataaagagaggatgctgcagaaggaactctaatctgtcattaacatcattgtgaggcagggcgaccaataccatgatactgacaatgcccttcaatgccaacatgaaataaatggctcataaatacactgtgttgaggacctgactaattatagccagagagcagattgttaaaataaactacacactgtatatagtgtaaataaagtacagagattatttttatatgcaaagtttatattttatataaaaaaaagaaaagaaaaaaaataaataaataattgtttccaaaaaaaaaaaaaaaaa
Translation: MSVPFHDYQGNMMEGEARDLRKDKLLQDDRIDSGLDSLKEEEYTAIITDLSNMRMEGPPDTSNYEPEPWKKEVNEDGDTFLHLAIIHEEKTLVKEAIQRSYRDHFYLNKQNNLHQTALHLAVITEQQDISQSLLQAGCDPEIQDFCGNTALHIACKQGSLRGVGVIFQYCEKQLPALLQSVNYDGHTCLHLASIHGYLAIVENLINKGADINAQEPCNGRTVLHMAVDLQNYDLMKLLLKHGADVNRVTYQGYSPCQLTWGRNNMLIQQQLVEVTHKNLQYLPESEEEDSSDSEYEYNDDELMYDDCIIGGRPLH
Donor tissue: gastrula