ORFeome > nipsnap3a – XORFeome 2.0

nipsnap3a – XORFeome 2.0

General Information

Species: Xenopus tropicalis nipsnap homolog 3A (C. elegans), mRNA (cDNA clone MGC:88968 IMAGE:7003516), complete cds
Gene Symbol: nipsnap3a
Gene ID: 448244
ORF gb_acc: MG134020
ORF ID: 11635

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC075307

Library Location

Plate ID: GDExt11016
Well Location: C07

EST Sequences

Clone: MGC:88968 IMAGE:7003516
Trimmed Sequence: ATGTGCAGTTTACGCTCCTTCTTTGCCAAGGGGAAATTGGCATCAACAGCTGCTTGTGCCTGGCGGGATCCGGCAGGTTTGGCTCAGATGCGAGCTACGTATGCAACAGGGCAACGTCAGGAAGACACAACTTTTTATGAATTTCGCACTTACACTGTAAAACCTGCAATGATGAGTGATTTCATGAAACTCACCAGTGAAAACATTCACATGCGCACAGCCCACTCAGAGTTGGTCGGCTATTGGACGCTAGAGTTTGGAGGCCTCAATAAAGTCTTCCATATCTGGAAATATGACAGCTTTGCCCAAAGAGCAGCAGTTAGAGCAAAGCTTGCCCAAGACAGAGACTGGCTGGACAAATATTTATTAAAAATGTTACCCATGCTGGACAAACAGGATAATGAAGTAACTTACTTGGTGCCTTGGTGCAAAGTGCAGAAGCCAGAAACAGAAGGGGTCTATGAGTTGGTCAGCTTTCAGTTCAAGCCTGGAGGGCCAGCAGTTTGGGGTCATGCCTTCAGAGCAGCAATTTCGACTCATGTTAACACTGGCTACACTAAGCTTATTGGTGTGTTCAACACAGAGTATGGATTACTTAACCAAGTGCATGTGCTATGGTGGAATGAAAATGCTGACAATCGGGCAGCTGGCAGACACAGGGCACATGAAGATGCTAGAGTGGTAGCAGCAGTCAGAGAGAGTTCAAGATTCCTGGAGTCCCAGAGGAACCTGTTGATGCTCCCAACCAAGTTCTCACCCATGAAATAA
Full Trace Sequence: ggccttaaaagcctgctgggcctctggctgccccctacatagcattaccctggcattaaactttatcataagcaggcaccaaagtttgctgcggcaccgtacggatcagcagtgtcatcatgatgtgcagtttacgctccttctttgccaaggggaaattggcatcaacagctgcttgtgcctggcgggatccggcaggtttggctcagatgcgagctacgtatgcaacagggcaacgtcaggaagacacaactttttatgaatttcgcacttacactgtaaaacctgcaatgatgagtgatttcatgaaactcaccagtgaaaacattcacatgcgcacagcccactcagagttggtcggctattggacgctagagtttggaggcctcaataaagtcttccatatctggaaatatgacagctttgcccaaagagcagcagttagagcaaagcttgcccaagacagagactggctggacaaatatttattaaaaatgttacccatgctggacaaacaggataatgaagtaacttacttggtgccttggtgcaaagtgcagaagccagaaacagaaggggtctatgagttggtcagctttcagttcaagcctggagggccagcagtttggggtcatgccttcagagcagcaatttcgactcatgttaacactggctacactaagcttattggtgtgttcaacacagagtatggattacttaaccaagtgcatgtgctatggtggaatgaaaatgctgacaatcgggcagctggcagacacagggcacatgaagatgctagagtggtagcagcagtcagagagagttcaagattcctggagtcccagaggaacctgttgatgctcccaaccaagttctcacccatgaaataatatcctgtaattctcctgcagatccttgggtgtccgcattatttagaactttttgccatgaacggatcacaagatgctaacatttgcatatataggctatatgtgaatattggttatttctgaaatatttggatcttatttcaaataaagacctaaaaatctcaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MCSLRSFFAKGKLASTAACAWRDPAGLAQMRATYATGQRQEDTTFYEFRTYTVKPAMMSDFMKLTSENIHMRTAHSELVGYWTLEFGGLNKVFHIWKYDSFAQRAAVRAKLAQDRDWLDKYLLKMLPMLDKQDNEVTYLVPWCKVQKPETEGVYELVSFQFKPGGPAVWGHAFRAAISTHVNTGYTKLIGVFNTEYGLLNQVHVLWWNENADNRAAGRHRAHEDARVVAAVRESSRFLESQRNLLMLPTKFSPMK
Donor tissue: