ORFeome > nr5a2 – XORFeome 2.0

nr5a2 – XORFeome 2.0

General Information

Species: Xenopus tropicalis nuclear receptor subfamily 5, group A, member 2, mRNA (cDNA clone MGC:89530 IMAGE:6993114), complete cds
Gene Symbol: nr5a2
Gene ID: 496513
ORF gb_acc: MG134318
ORF ID: 12000

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC084495

Library Location

Plate ID: GDExt11020
Well Location: F07

EST Sequences

Clone: MGC:89530 IMAGE:6993114
Trimmed Sequence: ATGCTGCCCAAAGTGGAGCCTGAAGCATTGGGACTGTCCAGATCACACGGGGAGCAGGGCCACATGCCGGAGAACATGCAAGCATCCCAGTTTAAAATGATGGGCTACTCCTACGACGAAGAACTTGAGGAGATGTGTCCTGTGTGTGGGGACAAGGTTTCAGGATATCATTATGGACTTCTGACCTGTGAGAGCTGCAAGGGATTCTTCAAGAGGACGGTTCAGAACAACAAGAGGTATACTTGCATTGAAAATCAGAGCTGCCAGATTGATAAAACCCAGAGGAAGAGATGTCCATACTGCAGGTTTCAGAAATGTTTGAGTGTGGGCATGAAGCTGGAAGCTGTGCGGGCAGATCGAATGCGTGGAGGGAGAAACAAATTTGGGCCAATGTACAAGAGGGACCGTGCATTAAAACAGCAGAAAAAGGCTTTAATTCGTGCCAATGGACTGAAACTAGAGGCTATGGGTCAAGTAATCCAGTCTATTCCCACTGATCTGACCATTTCTTCGGCCATACAGAACATTCACTCAGCATCCAAGGGACTACCTCTAAACCACGCTGCCCTGCCCCCATCAGACTATGATCGAAGCCCCTTTGTAACTTCCCCCATCAGTATGGCTATGCCGCCTCATGGCAGCCTGCAGGGTTACCAAGCTTATGGTCACTTTCCAAGCCGTGCTATTAAATCAGAATATCCAGACCCTTACACAAGTTCACCAGAATCCATAATGGGATACTCATACATGGACAGCTACCAGTCCAGTTCTCCCTCCAATATTCCTCACCTTATTGTTGAACTCTTGAAATGTGAGCCAGATGAACCTCAAGTACAGGGGAAGATCATGGCATATTTACAGCAGGAGCAGGCCAACAGGAGCAAACACGATAAACTCAATACCTTTGGACTCATGTGCAAAATGGCAGACCAGACACTATTTTCCATTGTTGAGTGGGCAAGGAGCAGCATTTTTTTCAGAGAGCTTAAGGTGGATGATCAGATGAAGCTATTGCAGAACTGCTGGAGTGAGTTACTAATTCTGGACCATATATTTCGGCAAGTTCTACATGGGAAAGAAGGTTCCATTCTGTTAGTCACGGGACAACAGGTGGATTACTCTGTCATTGTGACACAGGCCGGAGCCACATTAAATAACCTGATGAGCCATGCACAAGATCTTGTTGCCAAGCTTCGCTCGCTGCAGTTTGATTTGAGGGAATTTGTGTGCCTGAAATTCCTGGTGCTCTTTAGTCTGGATGTCAAGAACCTGGAGAATTACCAGTTGGTGGAAGGAGTTCAAGAACAAATTAATGCTGCGCTACTGGACTATACCATGTGCAATTATCCACAGCAAACTGATAAATTTGGCCAGCTGTTGCTACGGTTACCAGAAATTCGGGCAATAAGTTTGCAGGCCGAAGAATATTTGTATTATAAACACCTCAACGGGGATGTGCCATGTAACAATCTTCTCATCGAAATGCTCCATGCAAAGAGGGCCTAA
Full Trace Sequence: atcgggagccacaggagtgggactgtcaaactagatccgagagaagttgggggaaaggcagacggttctgggtggtccttccttcctcccttcagacctgagaggtgacagctgtagcactgagtctctcctgagccataagtagagaccccatgcagtgcagctgagtaacccacaccttacagatacctgcacccaggatacaccccacctacacccctgtagcattcactccccagtaactcatgctcccccgcaaaacttgctttatccggggattgtaaatccaattctgtcacaggagtctcctcgcagcagcttttcacttcacccagaagatcccatttgtattcctgatcaggtggtgccctttccaccctcagttctggggtctcatcctggtccctctgtgcgccccaggtggagctccccggcgccctctccctgcccgagcaatgctgcccaaagtggagcctgaagcattgggactgtccagatcacacggggagcagggccacatgccggagaacatgcaagcatcccagtttaaaatgatgggctactcctacgacgaagaacttgaggagatgtgtcctgtgtgtggggacaaggtttcaggatatcattatggacttctgacctgtgagagctgcaagggattcttcaagaggacggttcagaacaacaagaggtatacttgcattgaaaatcagagctgccagattgataaaacccagaggaagagatgtccatactgcaggtttcagaaatgtttgagtgtgggcatgaagctggaagctgtgcgggcagatcgaatgcgtggagggagaaacaaatttgggccaatgtacaagagggaccgtgcattaaaacagcagaaaaaggctttaattcgtgccaatggactgaaactagaggctatgggtcaagtaatccagtctattcccactgatctgaccatttcttcggccatacagaacattcactcagcatccaagggactacctctaaaccacgctgccctgcccccatcagactatgatcgaagcccctttgtaacttcccccatcagtatggctatgccgcctcatggcagcctgcagggttaccaagcttatggtcactttccaagccgtgctattaaatcagaatatccagacccttacacaagttcaccagaatccataatgggatactcatacatggacagctaccagtccagttctccctccaatattcctcaccttattgttgaactcttgaaatgtgagccagatgaacctcaagtacaggggaagatcatggcatatttacagcaggagcaggccaacaggagcaaacacgataaactcaatacctttggactcatgtgcaaaatggcagaccagacactattttccattgttgagtgggcaaggagcagcatttttttcagagagcttaaggtggatgatcagatgaagctattgcagaactgctggagtgagttactaattctggaccatatatttcggcaagttctacatgggaaagaaggttccattctgttagtcacgggacaacaggtggattactctgtcattgtgacacaggccggagccacattaaataacctgatgagccatgcacaagatcttgttgccaagcttcgctcgctgcagtttgatttgagggaatttgtgtgcctgaaattcctggtgctctttagtctggatgtcaagaacctggagaattaccagttggtggaaggagttcaagaacaaattaatgctgcgctactggactataccatgtgcaattatccacagcaaactgataaatttggccagctgttgctacggttaccagaaattcgggcaataagtttgcaggccgaagaatatttgtattataaacacctcaacggggatgtgccatgtaacaatcttctcatcgaaatgctccatgcaaagagggcctaaaaaacatttccccattgaactgcacacgttgcaaatactgtttaaagactttgtaaaggttataaaggtataatcagaactcatgaagtgatgcatcagggtatttgtatttcaaactgtgaaagacttatccacagaagattctatatggaactttctgcctgaatccaaaatggccacctgaacagaactgaaaactgtcagaactattattcatgtaaaaagaagctccaaagagaagctcagaaaaaaactgttctgttaaatatgtgtcaaagagaaggacctgagaagagctctatgttcaacctctccttgctagctcatttcaaatataaggttacagatgaagtctatgcatttccagatgtgttttgtttcatatatggtcggccaaaaatcaaaccaaaaaacaaaaaaacattttatatatatatatatatttgcatgtaaatgactctctccatttgtcgggtaaatgcctgcaaaatgcaaagcatggcagtcaagtatggcttccatatgtatgaggcccgtgttccccagattacatagagaagatcctgataccgaactacctgttaggccaaactaaatgtaacgcctggaacaccagatagctcctaatggattgctggcacctctggcactttaaagagctttaatgtgaattcttatgtctaaagtgtattaaaaggaaagaaagaaaatattgtgagaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MLPKVEPEALGLSRSHGEQGHMPENMQASQFKMMGYSYDEELEEMCPVCGDKVSGYHYGLLTCESCKGFFKRTVQNNKRYTCIENQSCQIDKTQRKRCPYCRFQKCLSVGMKLEAVRADRMRGGRNKFGPMYKRDRALKQQKKALIRANGLKLEAMGQVIQSIPTDLTISSAIQNIHSASKGLPLNHAALPPSDYDRSPFVTSPISMAMPPHGSLQGYQAYGHFPSRAIKSEYPDPYTSSPESIMGYSYMDSYQSSSPSNIPHLIVELLKCEPDEPQVQGKIMAYLQQEQANRSKHDKLNTFGLMCKMADQTLFSIVEWARSSIFFRELKVDDQMKLLQNCWSELLILDHIFRQVLHGKEGSILLVTGQQVDYSVIVTQAGATLNNLMSHAQDLVAKLRSLQFDLREFVCLKFLVLFSLDVKNLENYQLVEGVQEQINAALLDYTMCNYPQQTDKFGQLLLRLPEIRAISLQAEEYLYYKHLNGDVPCNNLLIEMLHAKRA
Donor tissue: neurula