ORFeome > otc – XORFeome 2.0

otc – XORFeome 2.0

General Information

Species: Xenopus tropicalis ornithine carbamoyltransferase, mRNA (cDNA clone MGC:89029 IMAGE:7005000), complete cds
Gene Symbol: otc
Gene ID: 448273
ORF gb_acc: MG134138
ORF ID: 11766

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC075343

Library Location

Plate ID: GDExt11017
Well Location: C04

EST Sequences

Clone: MGC:89029 IMAGE:7005000
Trimmed Sequence: ATGCTATCACATTTAAGGCATGTGTTTTCTGGGGCTCCTATACTAAATGCAAGCAAATGCACTGTACATCACTTTCGGTCATCACATTGCAATGTGCAGCTAAAAGGTCGGAACCTTTTAACTTTAAAACATTACACAGCTGAAGAAATACAATACCTTTTGTGGGTGGCAGCTGATCTTAAATACAGAATAAAGCAAAAAGGAGAGTATGTACCTGTGCTGCAGGGAAAATCTCTTGCCATGATATTTGAAAAAAGAAGTACGAGAACAAGACTCTCCACTGAAACTGGGTTTGCTTTACTTGGTGGACATCCTTGTTTTCTAACCACACAAGACATCCATTTGGGAGTTAATGAAAGCCTGAAGGATACAGCAAGGGTATTATCAGGAATGACTGATGCTGTTCTAGCAAGAGTTTATCGCCAAACTGACCTGGACCTTTTGGCTAAAGAGGCAACAATTCCAATTGTTAATGGTTTATCAGATATGTATCATCCTATCCAAATTCTAGCTGATTTCTTAACTTTGCAGGAACATTATGGCCATTTGAACGGACTAACCATATCCTGGATTGGAGATGGAAACAATGTCTTAAATTCAATTATGATGAGTGCTGCCAAGTTTGGAATGAACCTACGTATAGCAACACCAAAGGGTTATGAACCTGATTCCTCTGTAATTTCAGCAGCTGAACAGTTTTCCAAAGAGTCTGGCACACCGCTTTTTATGACAAATGAACCTCTGGAGGCTGCAACTGGAGCCAATGTTTTGGTGACCGACACCTGGGTAAGCATGGGAAAGGAAGAGGAGAAGAAGAAACGCTTAAAGGATTTTAAAGGATACCAGATAACAATGCAGACTGGTAAAGTTGCTTCTCCAGACTGGACATTTCTTCACTGTTTGCCAAGAAAGCCTGAAGAAGTGGATGATGCAGTTTTCTATTCTCCCAAATCTTTGGTTTTCCCAGAAGCAGAAAATAGGAAATGGACAATTATGGCCGTGATGGTTGCTTTATTGACTGATTATATTCCTCAACTACCAAAACCTACATTTTAA
Full Trace Sequence: cagacaccgagtactgcatttaacctctgttggggcaacagtcactttgaagaaatgctatcacatttaaggcatgtgttttctggggctcctatactaaatgcaagcaaatgcactgtacatcactttcggtcatcacattgcaatgtgcagctaaaaggtcggaaccttttaactttaaaacattacacagctgaagaaatacaataccttttgtgggtggcagctgatcttaaatacagaataaagcaaaaaggagagtatgtacctgtgctgcagggaaaatctcttgccatgatatttgaaaaaagaagtacgagaacaagactctccactgaaactgggtttgctttacttggtggacatccttgttttctaaccacacaagacatccatttgggagttaatgaaagcctgaaggatacagcaagggtattatcaggaatgactgatgctgttctagcaagagtttatcgccaaactgacctggaccttttggctaaagaggcaacaattccaattgttaatggtttatcagatatgtatcatcctatccaaattctagctgatttcttaactttgcaggaacattatggccatttgaacggactaaccatatcctggattggagatggaaacaatgtcttaaattcaattatgatgagtgctgccaagtttggaatgaacctacgtatagcaacaccaaagggttatgaacctgattcctctgtaatttcagcagctgaacagttttccaaagagtctggcacaccgctttttatgacaaatgaacctctggaggctgcaactggagccaatgttttggtgaccgacacctgggtaagcatgggaaaggaagaggagaagaagaaacgcttaaaggattttaaaggataccagataacaatgcagactggtaaagttgcttctccagactggacatttcttcactgtttgccaagaaagcctgaagaagtggatgatgcagttttctattctcccaaatctttggttttcccagaagcagaaaataggaaatggacaattatggccgtgatggttgctttattgactgattatattcctcaactaccaaaacctacattttaatccacagttaaagctatgaaatataacggagcaaactgaatctgtaaacatcaaaactaaaagataattttattgttttatatatacgcttgccaagtggaataaatatacatatagccagaaatctcttggtatctgctgtaaaacacattgtatttgcaaagtgtttttattttaaagggaaacttaactaaaatatctctgtcttaatcagtgattaaaatttagtattataaaaattttaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MLSHLRHVFSGAPILNASKCTVHHFRSSHCNVQLKGRNLLTLKHYTAEEIQYLLWVAADLKYRIKQKGEYVPVLQGKSLAMIFEKRSTRTRLSTETGFALLGGHPCFLTTQDIHLGVNESLKDTARVLSGMTDAVLARVYRQTDLDLLAKEATIPIVNGLSDMYHPIQILADFLTLQEHYGHLNGLTISWIGDGNNVLNSIMMSAAKFGMNLRIATPKGYEPDSSVISAAEQFSKESGTPLFMTNEPLEAATGANVLVTDTWVSMGKEEEKKKRLKDFKGYQITMQTGKVASPDWTFLHCLPRKPEEVDDAVFYSPKSLVFPEAENRKWTIMAVMVALLTDYIPQLPKPTF
Donor tissue: