ORFeome > otx1 – XORFeome 2.0

otx1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis orthodenticle homeobox 1, mRNA (cDNA clone MGC:75643 IMAGE:5379560), complete cds
Gene Symbol: otx1
Gene ID: 394824
ORF gb_acc: MG132841
ORF ID: 10192

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC063197

Library Location

Plate ID: GDExt11002
Well Location: H09

EST Sequences

Clone: MGC:75643 IMAGE:5379560
Trimmed Sequence: ATGATGTCATACCTCAAACAGCCCCCCTATGGCATGAATGGCTTGGGGCTAACGGGGCCTGCTATGGACTTATTGCATCCGTCTGTGGGATACCCAGCAACTCCGCGGAAGCAGCGCAGAGAGCGCACCACCTTTACCCGCTCGCAGCTGGATGTGCTGGAGGCCCTGTTCGCCAAGACTCGCTACCCGGACATATTCATGCGCGAAGAAGTCGCACTAAAGATCAACCTGCCGGAATCTAGAGTCCAGGTCTGGTTTAAGAACCGCAGAGCCAAGTGTCGGCAGCAGCAGCAGCAACAGCAGAGCAGCAGCGGGGCGGGAGTGAAGAGCAGACCGGCCAAGAAGAAGTGCAGCCCGGCCAGAGAGAGTTCGGGGTCGGAGAGCAGCGGCCAGTTCACTCCCCCCGCGGTGCCCAGCTCCGGCTCTTCCTCCTCGTCCTCCTCTTCCAGTTCCAATTCATCCGGGAACCCCGGCCTGGCTACAGCCCCGCTGAATGGCAGCACCTCCACAGCCTTCTCCATCTGGAGCCCGGCCTCCATTTCTCCGGGCACTGGCCCTGGGTCTGGCCCCGACCCCTTGGGAACAGGCAGCGCCTCCTGCATGCAACGCTCTGGCTCCTCATCTGCAGCTTCCTACCCCATGTCCTACAGTCAGGCAGCCGGCTACACCCAGGGCTATCCTGCCCCTTCTTCCTCCTACTTCAGCGGGGTGGATTGCAGCTCTTACCTGGCACCAATGCATTCTCACCATCACCCTCACCAGCTGAGCCCCATGGCCCCTTCCTCCATGTCTGGCCACCATCATCATCATCACCACCTGAGCCAGACCTCCAGCCATCACCACCACCACCACCATCACCAGGGCTATACCGGCACAGGCTTGCCCTTTAACTCCTCTGACTGTCTGGACTATAAGGAACAAGCCGCAGCGTCTTCTTGGAAACTCAACTTTAATTCCACCGACTGTCTGGACTACAAAGATCAGTCCTCCTGGAGGTTCCAGGTCTTGTGA
Full Trace Sequence: gtctcctggtgcggggaaggaaagagagaacccgattgtgtctcccgtcgggggattgggaaggagttgcctttgtggatactttggggggtttctgtccagccttgagcatgatgtcatacctcaaacagcccccctatggcatgaatggcttggggctaacggggcctgctatggacttattgcatccgtctgtgggatacccagcaactccgcggaagcagcgcagagagcgcaccacctttacccgctcgcagctggatgtgctggaggccctgttcgccaagactcgctacccggacatattcatgcgcgaagaagtcgcactaaagatcaacctgccggaatctagagtccaggtctggtttaagaaccgcagagccaagtgtcggcagcagcagcagcaacagcagagcagcagcggggcgggagtgaagagcagaccggccaagaagaagtgcagcccggccagagagagttcggggtcggagagcagcggccagttcactccccccgcggtgcccagctccggctcttcctcctcgtcctcctcttccagttccaattcatccgggaaccccggcctggctacagccccgctgaatggcagcacctccacagccttctccatctggagcccggcctccatttctccgggcactggccctgggtctggccccgaccccttgggaacaggcagcgcctcctgcatgcaacgctctggctcctcatctgcagcttcctaccccatgtcctacagtcaggcagccggctacacccagggctatcctgccccttcttcctcctacttcagcggggtggattgcagctcttacctggcaccaatgcattctcaccatcaccctcaccagctgagccccatggccccttcctccatgtctggccaccatcatcatcatcaccacctgagccagacctccagccatcaccaccaccaccaccatcaccagggctataccggcacaggcttgccctttaactcctctgactgtctggactataaggaacaagccgcagcgtcttcttggaaactcaactttaattccaccgactgtctggactacaaagatcagtcctcctggaggttccaggtcttgtgagcaatcagagaccatttctgcctgccatcctcttaaatatatatatatataaatatatgaataaagtatatgtggaagtgctgtgccaggcttgcctccagctggagtgaaggacatgaatgaacaatatatatattttttaatctgcttgtgggctagaattctgaatatatgaattaactgtgcctgtacaaaatggatagatatcccaccagtgttcttcaccatttagtggttttatttattcactgtctggacctgggatttggacaaatgtctgcctttgatgtgctctcagtacagccctgggacctgtggctaatctaatgttttaacccaaagtttctcattctataaagtgcaaggggcaggtgtgttgtgcccagtctgtatagagcccttcccctgaggttatatgatgtaggactcatttagcttcttgctgcccaggcggctggaatatgtacatatttatttaggtccgtttgtaggaccctttatttttagtttatattattggtttgatttccggacttctaactacagccccaccattaataacccctttactggagaccaaacctcttgcatattagatgttgtggcgtttccccactctatttattaaatacaaagtcttggagacgaaaaagaatgaagtttcatgcacccccgtgttcctgagaatgtgctcgcccgagtctggcttattgcactttgtgtagagtccacacttgtctgtcactgggaaatcgcacccacgtttgtttaacgggacagctctcagtatgtgtattgtcactcacatttactttctttcaatcccattagtgtcaccgctattcctgcttttcttacattctgtccgggcagcacttgcatttgtgtcactgaaaatttggctctgtttgtccctgtgtaggtgaggaaaattctgtttgtacatttggtgctccacaatggctatcgatgtaaggaaaagtcatttctacataccccccatcctttcaaataaaaatcaaactaataaaaaaaaaaaaaaaaaaaaa
Translation: MMSYLKQPPYGMNGLGLTGPAMDLLHPSVGYPATPRKQRRERTTFTRSQLDVLEALFAKTRYPDIFMREEVALKINLPESRVQVWFKNRRAKCRQQQQQQQSSSGAGVKSRPAKKKCSPARESSGSESSGQFTPPAVPSSGSSSSSSSSSSNSSGNPGLATAPLNGSTSTAFSIWSPASISPGTGPGSGPDPLGTGSASCMQRSGSSSAASYPMSYSQAAGYTQGYPAPSSSYFSGVDCSSYLAPMHSHHHPHQLSPMAPSSMSGHHHHHHHLSQTSSHHHHHHHHQGYTGTGLPFNSSDCLDYKEQAAASSWKLNFNSTDCLDYKDQSSWRFQVL
Donor tissue: tailbud