ORFeome > paf1 – XORFeome 2.0

paf1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis Paf1, RNA polymerase II associated factor, homolog, mRNA (cDNA clone MGC:76249 IMAGE:5378994), complete cds
Gene Symbol: paf1
Gene ID: 394974
ORF gb_acc:
ORF ID: 10230

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC064253

Library Location

Plate ID: GDExt11002
Well Location: G11

EST Sequences

Clone: MGC:76249 IMAGE:5378994
Trimmed Sequence: ATGGCTCCCACTATACAGACCCAGGCTCAGCGAGAGGACGGACACAGGTCCAGTTCTCATCGTACAGTACCAGAGAGATCAGGGGTTGTCTGTCGTGTAAAATACTGCAACACTCTTCCTGATATTCCCTTTGACCCCAAGTTTATAACCTACCCTTTTGACCAGAACAGATTTGTACAGTATAAAGCAACGTCGCTGGAGAAACAGCACAAGCATGACCTTCTGACAGAGCCAGATTTAGGGGTCACCATTGACCTAATTAACCCGGATACATATCGTATAGACCCCAATGTAACTCTTGATATTGCTGATGAGAAGCTTCTAGAAGAGGAAATCCAGGCCCCTAGCAGCTCCAAAAGATCTCAACAGCATGCTAAGGTGGTACCATGGATGAGGAAGACAGAATATATCTCCACCGAGTTTAACCGTTATGGTGTTTCCAATGAGAAACCAGAAGTAAAGATTGGAGTTTCTGTCAAGCAGCAGTTCACAGAGGAAGATATATATAAAGACCGGGACAGCCAGATTTCTGCCATTGAGAAGACCTTTGAAGATGCCCAGAAACCTATTTCACAACATTATAGCAAACCTCGTGTTACACCAGTGGAGGTCATGCCAGTCTTCCCAGATTTCAAGATGTGGATCAATCCCTGTGCTCAGGTTATATTTGACTCAGATCCAGCACCTAAGGATGCTTCAGGCTCTGCTGCTTTGGACATGATGTCTCAGGCCATGATTAGGGGCATGATGGATGAGGAAGGCAACCAGTTTGTAGCATACTTCCTACCAGGCGAGGAGACCATGAGGAAACGAAAGAGAGATCAAGAAGAGGGTCTGGATTACATGCCAGAAGATATATACGACTACAAGATAGCAAGAGAATATAACTGGAATGTAAAGAACAAGGCCAGCAAAGGATACGAGGAGAATTACTTCTTCATCTTTCGGGAAGGGGATGGGGTGTATTATAATGAACTGGAAACCAGAGTACGACTCAGTAAGAGGAGAGTTAAGGCTGGTGTACAGTCAGGTACAAATGCTGTGCTTGTAGTGAAACACAGAGACATGCATGAGAAGGAACTGGAAGCTCAGGAAGCACGAAGGGCTCAACTTGAGAATCATGAGCCAGAAGAGGAGGAAGAAATTGAGGTGGACCAGGAAACACAGGGATCAGATGCAGAAGACGGAGAAAAGGGCAGTGGAAGTGAGAAGGAAGGGAGCGGTGCAGAGCAATCTGGTAGTGAGAGTGAACGAGAGGAGGCTGAGGAAGAGGAGAAAGAAGATGAAGAGGAGAAAGAGAGTAGTGAAGAGGACCGTGCCGCTAGAGACAAGGAGGAGATCTTTGGTAGTGACGATGATGATAGTGATGAAGATGGACCTAATGAGAGTGGACAGGATGGAGAGGATAGTGGCAGTGATGACGAGGAAGAGAAAGGCCAGGGACGCAGAAGCCGTAGTGCAAGCAGTAGCCCGTTTGGCAGCGACCATTCACAACAGGAAAATGAGGACCAAAGTGCTAGTGATCAGGGCTCTGGGTCCAGTACGGGAAGTGACAGTGACTGA
Full Trace Sequence: catggctcccactatacagacccaggctcagcgagaggacggacacaggtccagttctcatcgtacagtaccagagagatcaggggttgtctgtcgtgtaaaatactgcaacactcttcctgatattccctttgaccccaagtttataacctacccttttgaccagaacagatttgtacagtataaagcaacgtcgctggagaaacagcacaagcatgaccttctgacagagccagatttaggggtcaccattgacctaattaacccggatacatatcgtatagaccccaatgtaactcttgatattgctgatgagaagcttctagaagaggaaatccaggcccctagcagctccaaaagatctcaacagcatgctaaggtggtaccatggatgaggaagacagaatatatctccaccgagtttaaccgttatggtgtttccaatgagaaaccagaagtaaagattggagtttctgtcaagcagcagttcacagaggaagatatatataaagaccgggacagccagatttctgccattgagaagacctttgaagatgcccagaaacctatttcacaacattatagcaaacctcgtgttacaccagtggaggtcatgccagtcttcccagatttcaagatgtggatcaatccctgtgctcaggttatatttgactcagatccagcacctaaggatgcttcaggctctgctgctttggacatgatgtctcaggccatgattaggggcatgatggatgaggaaggcaaccagtttgtagcatacttcctaccaggcgaggagaccatgaggaaacgaaagagagatcaagaagagggtctggattacatgccagaagatatatacgactacaagatagcaagagaatataactggaatgtaaagaacaaggccagcaaaggatacgaggagaattacttcttcatctttcgggaaggggatggggtgtattataatgaactggaaaccagagtacgactcagtaagaggagagttaaggctggtgtacagtcaggtacaaatgctgtgcttgtagtgaaacacagagacatgcatgagaaggaactggaagctcaggaagcacgaagggctcaacttgagaatcatgagccagaagaggaggaagaaattgaggtggaccaggaaacacagggatcagatgcagaagacggagaaaagggcagtggaagtgagaaggaagggagcggtgcagagcaatctggtagtgagagtgaacgagaggaggctgaggaagaggagaaagaagatgaagaggagaaagagagtagtgaagaggaccgtgccgctagagacaaggaggagatctttggtagtgacgatgatgatagtgatgaagatggacctaatgagagtggacaggatggagaggatagtggcagtgatgacgaggaagagaaaggccagggacgcagaagccgtagtgcaagcagtagcccgtttggcagcgaccattcacaacaggaaaatgaggaccaaagtgctagtgatcagggctctgggtccagtacgggaagtgacagtgactgaatctggctaaacatgcttttccccccccccccaacttcttgtaaatacatctgtgtatattgctttcttagtccaataaaggatattcctgaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MAPTIQTQAQREDGHRSSSHRTVPERSGVVCRVKYCNTLPDIPFDPKFITYPFDQNRFVQYKATSLEKQHKHDLLTEPDLGVTIDLINPDTYRIDPNVTLDIADEKLLEEEIQAPSSSKRSQQHAKVVPWMRKTEYISTEFNRYGVSNEKPEVKIGVSVKQQFTEEDIYKDRDSQISAIEKTFEDAQKPISQHYSKPRVTPVEVMPVFPDFKMWINPCAQVIFDSDPAPKDASGSAALDMMSQAMIRGMMDEEGNQFVAYFLPGEETMRKRKRDQEEGLDYMPEDIYDYKIAREYNWNVKNKASKGYEENYFFIFREGDGVYYNELETRVRLSKRRVKAGVQSGTNAVLVVKHRDMHEKELEAQEARRAQLENHEPEEEEEIEVDQETQGSDAEDGEKGSGSEKEGSGAEQSGSESEREEAEEEEKEDEEEKESSEEDRAARDKEEIFGSDDDDSDEDGPNESGQDGEDSGSDDEEEKGQGRRSRSASSSPFGSDHSQQENEDQSASDQGSGSSTGSDSD
Donor tissue: tailbud