ORFeome > pald – XORFeome 2.0

pald – XORFeome 2.0

General Information

Species: Xenopus tropicalis paladin, mRNA (cDNA clone MGC:89269 IMAGE:6976892), complete cds
Gene Symbol: pald
Gene ID: 448380
ORF gb_acc: MG133800
ORF ID: 11372

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC075467

Library Location

Plate ID: GDExt11013
Well Location: E10

EST Sequences

Clone: MGC:89269 IMAGE:6976892
Trimmed Sequence: ATGGGTACAACTGCCAGTGCAGCTCAGCAGGTGCCCTCAACAGTGCCCTCTAGTGAAAACGTTCAGGGTAATGGAAGTGGAAGCTCAAATGTTGAAGATCGCAATTCCCTGAGCACACAGTCATTTCAGAATGTCAGCATCCACAACAAGGCAAAGTCAATAATCACCAATAAGGTGGCACCTGTAGTAATCACGTATAATTGCAAAGAAGAGTTTCAGATTCATGATGATCTACTCAAAGCTAATTATTCAGTTGGAAGAATTTCAGAGACAATGCCAGAACACTATCTTGTCCAGGGTAAATATTTTATGGTACATGACGTATATAGCAAATTGGATGTGTTAAACACTACTAGTAGTTGTGGTGCGCCGAACTTTCGCCAAGCAAGAGGAGGATATGAAGTTTATGGAATGGGCCAGCCCAGCTTAAATGGCTTCAAACAAGTGCTGCAAAAGCTTCAGAGCAATGGCCACAAGGAATGTGTCTTCTTCTGTGTGCGTGAGGAACCTGTACTGTTCTTAAAGTTGGAGGATGACTTTGTGCCTTACACTCCCAGGAGGAAGGAGAATTTGCATGAAAACTTGCATGATTTAGAGAAAGGACTGCGTGCAGAAAATCTTGAGCTTGCCATACGGAAAGAGCTGCACGACTTTGCCCAGCTCAGTGGAAACAGTTACTATGTATACAACGATATTGAACATTTTAAAGACGAACCACATTCGATTATAATCCACTGTGAAGAAGATATCCATGTCACAGAGGAGGTGTATAACAGGCCTGTATTCTTACTGCCAGCATACAGGTACCATCGCCTGCCCCTTCCTATGGATGGTGCTCCCTTAGAAACTCAGTTTGATGCATTTGTAAATATTCTCAGGGAAAATCCAAGTCTTTTGCTACTCCATGATGCCAACCACCCACCACCTGCCCTCTTGTTTAGCTGCCAGACGGGAGTGGGCAGAACTAACTTAGCCATGATTCTGGGAACACTGGTTCTGTATCACCGGAAAGGAGCCTGTGAGAAGCAAACCATCTCCCAGGATACAAATGTTTTGCCAAAGCAACGTTTTCAGGTTATCCAGAATTTTATCAACATGGTACCAAATGGAGAAGCAATAGTTGATGAGGTTGATAAAGCTATCGAGTTATGCTCAGAAATGCATGATATTAAAGCAGCTCTGTATGAGTGTAAAAAGAAGCTGGAAGGCATAGGAGAAGGCTACCAAATTCAGGGAAGTTCGACCAAAGAATATTTTCTCAAAGGAACCCTCCATAGTTTGGAGCGATATTTTTATTTAATAACTTTCAACTATTACCTTCATGAGCAGTACCCCTTGGCTTTTGCACTGAGTTTCAGCAAGTGGATGTGTACGCAGCCGTGGATCTACAGATTGCAAGCAAGCCTCAATCTGTCTGAGCTCACTTTATCAGGAGAACTTATAACAAAGGGAACCCGTGTTTTAGTACTGGATGATCGGTTCTCTCCTGATGTGCTAAGTACCCTGAAAGAGATGAACGTAGCTAATTTTAGAAGAGTGCCCAAAATGCCAGTCTATGGTACTGCACAACCAAGCTTGAAGGCTACAGGTAGTGTACTCAGTTATCTGACAGATGCAAAGCGGAAGTATTCCAACATTCTGTGGGTAAACCTTCGAGAAGATGTCATACTGGAAGCAAATGAACAAATATTCACCCCACGTGAACCAGATAATTTGGAGCAACAAATTGCAGTGCCTGCAGCTTCACCAGAGCAACTAGAGAAATTGGAGGCCACAGTTGCAAACCATGTCCTCACTTCCCAAAAGTGGCTTGAAGTCTACCTTGAACAAGAGAAGCAAATGAAAATGTTCAAAACCTGTCGGACTATGCAGGAGATTTTCAACCAACATAGAAGTGCCTATCCAGGTTTGGTGTACAGAAGGATTCCCATTCCGGATTTCTGTGCACCCAGGGAACAGGATTTTGACATGCTTCTGCAGTCCATGAAGAGCATGCTAGCAGAGGACTCCAGTGCAGCCTTTGTATTTAACTGTCATGGTGGCAAAGGAAGGACAACTACTGCTATGGTCATCGCTGTGCTTACTCTCTGGCATTTTAATAGCATTCCTGAAATTACTGAGGATGAAATTGTAAGTGTGCCAGACGCAAAATACACCAAGGGAGAGTTTGAGGTTGTGATGAAGATTGTGCAGCTTTTGCCAGATGGGCACAAAATAAAGAAGGAAGTAGACATGGCTCTTGACAGTATTAGTGAAACCATGACTCCTATGCATTACCACTTGCGAGAAATCATTATTTGCACCTATAGACAGGTTAAAACAGCTAAGAATTCAAAGGAAATGAGACTTCTCCAGCTCAGAAGCCTTCAGTACTTGGAGCGATACATCTACCTAATCCTTTTCAATGCCTATCTGCACTTGGAGAAGAAGGACACTTGGCAAAGGCCATTTAGCACCTGGATGTATGAGGTGGCATCCAAAGCTGGGGTTTATGAAGTGCTGAATCAGCTGGGATTTAGTGAATTTGAAAATGCAGAAGAACAGCCACTATGCCGGCTGCGTTATCGCTGGCAACAGCAAAACACCAACCTGCTTCCATTCCGAGGAGAATTTATTTAG
Full Trace Sequence: agcttttttccctctgttgtgtcagtgctgccagaatttcttccccgtacccacacactttgttcctatcttgcgccttctctctccccctcctgtgccatataaccggctcgcttcttcctattagacttacgtctggcattctcccttttgcagcaacttccactaaactcgttgtctcttggatacggagccgctcctttcagccccaggagccatgcagcagtcccagccatggcgcttgtggagtatgggtacaactgccagtgcagctcagcaggtgccctcaacagtgccctctagtgaaaacgttcagggtaatggaagtggaagctcaaatgttgaagatcgcaattccctgagcacacagtcatttcagaatgtcagcatccacaacaaggcaaagtcaataatcaccaataaggtggcacctgtagtaatcacgtataattgcaaagaagagtttcagattcatgatgatctactcaaagctaattattcagttggaagaatttcagagacaatgccagaacactatcttgtccagggtaaatattttatggtacatgacgtatatagcaaattggatgtgttaaacactactagtagttgtggtgcgccgaactttcgccaagcaagaggaggatatgaagtttatggaatgggccagcccagcttaaatggcttcaaacaagtgctgcaaaagcttcagagcaatggccacaaggaatgtgtcttcttctgtgtgcgtgaggaacctgtactgttcttaaagttggaggatgactttgtgccttacactcccaggaggaaggagaatttgcatgaaaacttgcatgatttagagaaaggactgcgtgcagaaaatcttgagcttgccatacggaaagagctgcacgactttgcccagctcagtggaaacagttactatgtatacaacgatattgaacattttaaagacgaaccacattcgattataatccactgtgaagaagatatccatgtcacagaggaggtgtataacaggcctgtattcttactgccagcatacaggtaccatcgcctgccccttcctatggatggtgctcccttagaaactcagtttgatgcatttgtaaatattctcagggaaaatccaagtcttttgctactccatgatgccaaccacccaccacctgccctcttgtttagctgccagacgggagtgggcagaactaacttagccatgattctgggaacactggttctgtatcaccggaaaggagcctgtgagaagcaaaccatctcccaggatacaaatgttttgccaaagcaacgttttcaggttatccagaattttatcaacatggtaccaaatggagaagcaatagttgatgaggttgataaagctatcgagttatgctcagaaatgcatgatattaaagcagctctgtatgagtgtaaaaagaagctggaaggcataggagaaggctaccaaattcagggaagttcgaccaaagaatattttctcaaaggaaccctccatagtttggagcgatatttttatttaataactttcaactattaccttcatgagcagtaccccttggcttttgcactgagtttcagcaagtggatgtgtacgcagccgtggatctacagattgcaagcaagcctcaatctgtctgagctcactttatcaggagaacttataacaaagggaacccgtgttttagtactggatgatcggttctctcctgatgtgctaagtaccctgaaagagatgaacgtagctaattttagaagagtgcccaaaatgccagtctatggtactgcacaaccaagcttgaaggctacaggtagtgtactcagttatctgacagatgcaaagcggaagtattccaacattctgtgggtaaaccttcgagaagatgtcatactggaagcaaatgaacaaatattcaccccacgtgaaccagataatttggagcaacaaattgcagtgcctgcagcttcaccagagcaactagagaaattggaggccacagttgcaaaccatgtcctcacttcccaaaagtggcttgaagtctaccttgaacaagagaagcaaatgaaaatgttcaaaacctgtcggactatgcaggagattttcaaccaacatagaagtgcctatccaggtttggtgtacagaaggattcccattccggatttctgtgcacccagggaacaggattttgacatgcttctgcagtccatgaagagcatgctagcagaggactccagtgcagcctttgtatttaactgtcatggtggcaaaggaaggacaactactgctatggtcatcgctgtgcttactctctggcattttaatagcattcctgaaattactgaggatgaaattgtaagtgtgccagacgcaaaatacaccaagggagagtttgaggttgtgatgaagattgtgcagcttttgccagatgggcacaaaataaagaaggaagtagacatggctcttgacagtattagtgaaaccatgactcctatgcattaccacttgcgagaaatcattatttgcacctatagacaggttaaaacagctaagaattcaaaggaaatgagacttctccagctcagaagccttcagtacttggagcgatacatctacctaatccttttcaatgcctatctgcacttggagaagaaggacacttggcaaaggccatttagcacctggatgtatgaggtggcatccaaagctggggtttatgaagtgctgaatcagctgggatttagtgaatttgaaaatgcagaagaacagccactatgccggctgcgttatcgctggcaacagcaaaacaccaacctgcttccattccgaggagaatttatttaggaaaactgcaaccctcaccaagatattgcagcagacgaatgcctaacgggacttggttcatgtaatcaaagaatggacacaaaaaaactgccagccaagatattttacaggaatttattgataataaaataaatgatcattttagaaaagtccttaattggaatagatgatggaatgtcataatgagaaggagaatgttgattctttcaccagtttaaagcagcacattccaccaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MGTTASAAQQVPSTVPSSENVQGNGSGSSNVEDRNSLSTQSFQNVSIHNKAKSIITNKVAPVVITYNCKEEFQIHDDLLKANYSVGRISETMPEHYLVQGKYFMVHDVYSKLDVLNTTSSCGAPNFRQARGGYEVYGMGQPSLNGFKQVLQKLQSNGHKECVFFCVREEPVLFLKLEDDFVPYTPRRKENLHENLHDLEKGLRAENLELAIRKELHDFAQLSGNSYYVYNDIEHFKDEPHSIIIHCEEDIHVTEEVYNRPVFLLPAYRYHRLPLPMDGAPLETQFDAFVNILRENPSLLLLHDANHPPPALLFSCQTGVGRTNLAMILGTLVLYHRKGACEKQTISQDTNVLPKQRFQVIQNFINMVPNGEAIVDEVDKAIELCSEMHDIKAALYECKKKLEGIGEGYQIQGSSTKEYFLKGTLHSLERYFYLITFNYYLHEQYPLAFALSFSKWMCTQPWIYRLQASLNLSELTLSGELITKGTRVLVLDDRFSPDVLSTLKEMNVANFRRVPKMPVYGTAQPSLKATGSVLSYLTDAKRKYSNILWVNLREDVILEANEQIFTPREPDNLEQQIAVPAASPEQLEKLEATVANHVLTSQKWLEVYLEQEKQMKMFKTCRTMQEIFNQHRSAYPGLVYRRIPIPDFCAPREQDFDMLLQSMKSMLAEDSSAAFVFNCHGGKGRTTTAMVIAVLTLWHFNSIPEITEDEIVSVPDAKYTKGEFEVVMKIVQLLPDGHKIKKEVDMALDSISETMTPMHYHLREIIICTYRQVKTAKNSKEMRLLQLRSLQYLERYIYLILFNAYLHLEKKDTWQRPFSTWMYEVASKAGVYEVLNQLGFSEFENAEEQPLCRLRYRWQQQNTNLLPFRGEFI
Donor tissue: tailbud