ORFeome > pcbp2 – XORFeome 2.0

pcbp2 – XORFeome 2.0

General Information

Species: Xenopus tropicalis poly(rC) binding protein 2, mRNA (cDNA clone MGC:69512 IMAGE:5336447), complete cds
Gene Symbol: pcbp2
Gene ID: 448044
ORF gb_acc: MG133384
ORF ID: 10891

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC074565

Library Location

Plate ID: GDExt11008
Well Location: H10

EST Sequences

Clone: MGC:69512 IMAGE:5336447
Trimmed Sequence: ATGGACACCGGTGTGATTGAAGGGGGCCTGAATGTTACACTCACCATCAGATTGCTTATGCATGGGAAGGAAGTTGGAAGCATTATTGGAAAGAAGGGGGAATCTGTTAAAAAGATGCGTGAAGAGAGCGGTGCCCGGATAAACATCTCAGAAGGGAATTGTCCAGAAAGGATAATTACCCTGGCTGGTCCTACGAACGCAATCTTTAAAGCCTTCTCTATGATAATTGATAAACTGGAAGAGGATATCAGCAGCTCCATGACCAACAGCACTGCATCTAGCAAACCTCCGGTTACTTTGCGTCTGGTGGTTCCAGCAAGTCAGTGTGGATCCCTCATTGGCAAAGGTGGCTGCAAAATAAAGGAAATAAGAGAAAGTACAGGAGCTCAGGTACAAGTGGCTGGGGACATGCTGCCTAATTCTACAGAGCGAGCAATCACCATTGCTGGCATTCCGCAGTCAATTATAGAGTGTGTCAAACAGATCTGTGTAGTCATGCTGGAGTCTCCCCCAAAAGGTGTCACCATCCCTTACCGGCCTAAACCTTCCAGTTCACCTGTAATCTTCGCAGGTGGTCAGGTGTCGCGCCAAGCCGGAGGGCACGCATGTGAGACTGACCTGTGGGAGGGGCGAAGGTCCCACACAGGGGGGGTCTCCCTAGATGCTGTGGATCTCCATGGGGCTTATACCATCCAGGGACAGTATGCCATTCCTCAGCCTGATCTGACCAAGTTGCACCAACTAGCAATGCAGCAGTCTCACTTTCCAATGTCCCATAGTGGCAACACTGGATTTAGTGGTGGGATTGATGCTTCAGCTCAGACGACTTCTCATGAACTCACCATTCCAAATGATCTCATCGGTTGTATCATTGGACGACAGGGAGCTAAAATAAATGAAATTCGTCAGATGTCTGGGGCTCAGATAAAAATAGCTAACCCTGTGGAGGGTTCAAATGATCGCCAGGTGACCATAACTGGATCCACAGCCAGCATTAGTTTGGCCCAGTACCTTATTAATGTCAGGCTTTCCTCAGAAGCTGGTGGCATGGGAAGCAGTTAG
Full Trace Sequence: agcagaggcagcagcagaagccgcagctcccgccagcccctcccgccgtcgccattcctcgcccgcccggctctctccttccctccctccccggggccccttgcctccggaccgttccttcctccccattcctcccttgttttcctaccccctttccccattttcttaatcgctctcacttttcccgcccttccaccttacggcggtcacctcttgtcctttgtaactccgcagtcttgtctcatcctgtgaccaaagatttgactactttgtacagcttctgacaatagccctgatccaacagaactagactcatcatggacaccggtgtgattgaagggggcctgaatgttacactcaccatcagattgcttatgcatgggaaggaagttggaagcattattggaaagaagggggaatctgttaaaaagatgcgtgaagagagcggtgcccggataaacatctcagaagggaattgtccagaaaggataattaccctggctggtcctacgaacgcaatctttaaagccttctctatgataattgataaactggaagaggatatcagcagctccatgaccaacagcactgcatctagcaaacctccggttactttgcgtctggtggttccagcaagtcagtgtggatccctcattggcaaaggtggctgcaaaataaaggaaataagagaaagtacaggagctcaggtacaagtggctggggacatgctgcctaattctacagagcgagcaatcaccattgctggcattccgcagtcaattatagagtgtgtcaaacagatctgtgtagtcatgctggagtctcccccaaaaggtgtcaccatcccttaccggcctaaaccttccagttcacctgtaatcttcgcaggtggtcaggtgtcgcgccaagccggagggcacgcatgtgagactgacctgtgggaggggcgaaggtcccacacagggggggtctccctagatgctgtggatctccatggggcttataccatccagggacagtatgccattcctcagcctgatctgaccaagttgcaccaactagcaatgcagcagtctcactttccaatgtcccatagtggcaacactggatttagtggtgggattgatgcttcagctcagacgacttctcatgaactcaccattccaaatgatctcatcggttgtatcattggacgacagggagctaaaataaatgaaattcgtcagatgtctggggctcagataaaaatagctaaccctgtggagggttcaaatgatcgccaggtgaccataactggatccacagccagcattagtttggcccagtaccttattaatgtcaggctttcctcagaagctggtggcatgggaagcagttagacctcttctgacatcttttctgtttagctcactgtcagtctgcacatccctgcaaacagcctcttttcaggttttaactagtttgcaatctgtttccttatgctttccctcttccactcattcataatttttttttgagaatatttttaatttttccccttccagttgttaaaacctgctgatacagattttagttttataaaaagtttgtcctgtaccctatcaaattttttttttttaaggttaaaaatgtcacattgtaaagagtggggtaataaatgcatttcaatttagttctgtaatgtcaggattttttcagaaaacaagtaaataaagacggactggaacttgaaaaaaaaccaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MDTGVIEGGLNVTLTIRLLMHGKEVGSIIGKKGESVKKMREESGARINISEGNCPERIITLAGPTNAIFKAFSMIIDKLEEDISSSMTNSTASSKPPVTLRLVVPASQCGSLIGKGGCKIKEIRESTGAQVQVAGDMLPNSTERAITIAGIPQSIIECVKQICVVMLESPPKGVTIPYRPKPSSSPVIFAGGQVSRQAGGHACETDLWEGRRSHTGGVSLDAVDLHGAYTIQGQYAIPQPDLTKLHQLAMQQSHFPMSHSGNTGFSGGIDASAQTTSHELTIPNDLIGCIIGRQGAKINEIRQMSGAQIKIANPVEGSNDRQVTITGSTASISLAQYLINVRLSSEAGGMGSS
Donor tissue: tailbud