ORFeome > pdk4 – XORFeome 2.0

pdk4 – XORFeome 2.0

General Information

Species: Xenopus tropicalis pyruvate dehydrogenase kinase, isozyme 4, mRNA (cDNA clone MGC:79644 IMAGE:6980152), complete cds
Gene Symbol: pdk4
Gene ID: 448511
ORF gb_acc: MG133741
ORF ID: 11309

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC076674

Library Location

Plate ID: GDExt11012
Well Location: C08

EST Sequences

Clone: MGC:79644 IMAGE:6980152
Trimmed Sequence: ATGAAGTTTGCCCGGTTCCTATTGAAGAATGCAGCCTTGGCAAATGCCCCCAAACAGATTGAGAGGTTCAGTCGCTTCTCCCCTTCCCCACTCTCCATGAAGCAGTTCATAGACTTTGGTTCTGCCAATGGCTGTGAGAAGACCTCCTTTGCATTCCTCCGACAAGAGCTTCCAGTAAGACTGGCCAACATCATGAGGGAGCTCTATATACTTCCTGACCAGTTGCTGGGGACACCATCGGTGCAGCTTGTCCAAAGCTGGTACATACAGAGCTTGATGGAGCTAATAGAATTTGTTGAAAGAAACCCGGAGGACCAAAGAGTGCTGTCTGATTTCACAGAGGCTCTCGTGACAATCCGGAACAGACACAACAATGTTGTCCCTACAATGGCTCAGGGAGTTATAGAATACAAGGAGGCATTTGGAGTGGACCCTGTCACCAATCAAAATGTTCAGTATTTTCTTGATCGCTTTTACATGAGCCGCATTTCTATACGGATGCTTATAAACCAGCACACTCTTCTTTTTGATGGAGGAACCAACCCAGCCCACCCAAAACACATTGGAAGCATTGATCCAAACTGTGATGTGGTTGAGGTAGTGCATGATGCTTTTGACACTGCCAAGATGCTTTGTGAACAGTACTATTTAGCTTCTCCCAAGCTGATAATAAGGCAGGCAAATGGCAAAGATCCTACCCAGCCGATTCATATAGTATATGTTCCATCACATCTCTATCACATGCTTTTTGAGCTTTTTAAGAATGCCATGCGGGCAACGATTGAAAATCATGAAACCAGTTCCCACCTACCTCCAGTTGAAGTGAATGTTGTCCTAGGAAACGAAGATCTTACTATTAAGATATCAGACAACGGAGGGGGCGTTCCCTTGCGGAAGATCGAACGACTGTTCAGTTACATGTATTCCACAGCACCCAGGCCTCTGATGGATAATTCACGGAATGCTCCTTTGGCTGGTTTTGGGTATGGATTGCCCATCTCTCGACTTTATGCCAGGTACTTCCAGGGTGACTTAATGCTGCAATCAATGGAGGGCTTCGGGACAGATGCAGTTATTTATTTAAAGGCATTATCAACAGAGTCTGTAGAGAGATTACCTGTATTCAACAAGTCTGCCTGGAAACATTATAAATTCTGCACTGAAGCAGATGATTGGTGCATTCCAAGCAGCGAACCAAAGAACCTGGCAAGGTAG
Full Trace Sequence: agaagggatgcgctgaagctaaaaagaaggaataggacattccattgtgccacaaactgtacccagcacaggagcaggcagtgtgtgcgatagcagccacaggggacttgtacaccattcatttgagtgaacccggccagaacgaaggaaggaaactgcagcccctgctgaatcttgttccccaccatcctgagcaagtccttccttttctcacagcaataggaggtgcacgaaaggctactaccggacctgcaagcagcctgcccccaccccccacacaagttgaagcgacctccaagtcaacatgaagtttgcccggttcctattgaagaatgcagccttggcaaatgcccccaaacagattgagaggttcagtcgcttctccccttccccactctccatgaagcagttcatagactttggttctgccaatggctgtgagaagacctcctttgcattcctccgacaagagcttccagtaagactggccaacatcatgagggagctctatatacttcctgaccagttgctggggacaccatcggtgcagcttgtccaaagctggtacatacagagcttgatggagctaatagaatttgttgaaagaaacccggaggaccaaagagtgctgtctgatttcacagaggctctcgtgacaatccggaacagacacaacaatgttgtccctacaatggctcagggagttatagaatacaaggaggcatttggagtggaccctgtcaccaatcaaaatgttcagtattttcttgatcgcttttacatgagccgcatttctatacggatgcttataaaccagcacactcttctttttgatggaggaaccaacccagcccacccaaaacacattggaagcattgatccaaactgtgatgtggttgaggtagtgcatgatgcttttgacactgccaagatgctttgtgaacagtactatttagcttctcccaagctgataataaggcaggcaaatggcaaagatcctacccagccgattcatatagtatatgttccatcacatctctatcacatgctttttgagctttttaagaatgccatgcgggcaacgattgaaaatcatgaaaccagttcccacctacctccagttgaagtgaatgttgtcctaggaaacgaagatcttactattaagatatcagacaacggagggggcgttcccttgcggaagatcgaacgactgttcagttacatgtattccacagcacccaggcctctgatggataattcacggaatgctcctttggctggttttgggtatggattgcccatctctcgactttatgccaggtacttccagggtgacttaatgctgcaatcaatggagggcttcgggacagatgcagttatttatttaaaggcattatcaacagagtctgtagagagattacctgtattcaacaagtctgcctggaaacattataaattctgcactgaagcagatgattggtgcattccaagcagcgaaccaaagaacctggcaaggtagaaaggcgtctcggacttttcctgtaagctggaaaagggatcaagcacctgtctcccaggaccactacctgcaagtgttctgctgcaataaataggccacgtgtactgtgcttgagttggcccatgatgcaacaaggagagcaagtcacccaccaccaccagaagatgcaggatctttagatagtagtatagcactttttggctaattcatttgatattaagcactcagggtatattctgtgccctaagaaatgtttgatttgttctgtttattaaatataacaatgtgttactaaaagtgatgagctaaagatcactgtgaattcagaatccaatctagaatataattctagctgtgatgttttttcccatattaccaagctcatggtaaaacataaatcacctactcttaatgccgaccacagcacagatgtttctttacctttgtctggtaaccaaatcatgtgtgaataccatattgccaaaaagagccagaaggtagctggtttgtttcatgacttgaagcatactgtgaaacaaacccattctgcccacagctgggcaccatcttgtactgtattccttattctctagtggaaagaggaatttgcagaacgtacagtatttttttataccgtcatgcagaagaatagattcaaatctacctttcaagcaaatatgcaaaataagtttaacactggcttttctgtaaaatgagagccagatcagaaaggtagtcctaatttctgtattttagctggagatgtatagtctctgttgtatattcagaaagaacattttagcccttcaaacagaatctggccttatgttctatgtccttgcttgtgctcatgacattgtatctctttaaggaaaccagtttgttgtgaccatttgaaagcactgtgccatatgacaagtaatactgcataattcactactgaaggattctgtagcctcttaatatttgtttattctatggtattgatgtgcattctgcagcccctcagttcttctactacagttcccatcatgctctagttggattatggggtatagagttgcgggtacagccctgtcttatgctgttgtagtggagacaatggccgaaactactaggtctagaggggataaaatatagattttaaaaattcctgcagtacctagagccatttgtaggcctgaacccattgtgtctccacgtcaagcacgcatttgaatattgtgaattgatgctgctctaatagatccagtatggaactgcaatacatgagtacctccagtacttaggcacatacaagaagtatgatctaatgaaaatgtcgactatgcattgttttaccttatacctgtactaatatgccattcatatttattgcctttttattattccttagccatggggccttttactaagttccaaatgtttttaatcatttttccattaatatattttctcttgctttgttttttatggcagaatattgccttaaaatgttatttattccagattgaaacttatattttgctgatatgcctccattttgcttgtgcatttgtgtctccattgttggaacttactttaaggcattatgatgcagttattagcatgaattattaggcattaaatctctttgcttcgtgtaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MKFARFLLKNAALANAPKQIERFSRFSPSPLSMKQFIDFGSANGCEKTSFAFLRQELPVRLANIMRELYILPDQLLGTPSVQLVQSWYIQSLMELIEFVERNPEDQRVLSDFTEALVTIRNRHNNVVPTMAQGVIEYKEAFGVDPVTNQNVQYFLDRFYMSRISIRMLINQHTLLFDGGTNPAHPKHIGSIDPNCDVVEVVHDAFDTAKMLCEQYYLASPKLIIRQANGKDPTQPIHIVYVPSHLYHMLFELFKNAMRATIENHETSSHLPPVEVNVVLGNEDLTIKISDNGGGVPLRKIERLFSYMYSTAPRPLMDNSRNAPLAGFGYGLPISRLYARYFQGDLMLQSMEGFGTDAVIYLKALSTESVERLPVFNKSAWKHYKFCTEADDWCIPSSEPKNLAR
Donor tissue: tailbud