ORFeome > pdlim4 – XORFeome 2.0

pdlim4 – XORFeome 2.0

General Information

Species: Xenopus tropicalis PDZ and LIM domain 4, mRNA (cDNA clone MGC:75597 IMAGE:5379217), complete cds
Gene Symbol: pdlim4
Gene ID: 394862
ORF gb_acc: MG132791
ORF ID: 10116

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC063900

Library Location

Plate ID: GDExt11002
Well Location: H06

EST Sequences

Clone: MGC:75597 IMAGE:5379217
Trimmed Sequence: ATGTTCCTCAGCGTCACTCTCAGTGGCCCTTCACCCTGGGGATTTAGGCTGGTGGGGGGCAGGGACTACAACACCCCTCTGACTATTTCAAAGATTAACCCTGGGAGCAAGGCGGAATTGGCTAACCTGTATCCAGGAGATGTTATCCTGGAAATCAATGGGGAGAACACGGAGAACATGAATCACCTAGTTGCTCAAAACAAGATTAAGGCCTGCACAGATCAACTGATGCTTTCCATAAACAGACGTGATGGAAGAACCTTGTTAAATGAAGAAGAACTGAAAAGGCAGCAACGTAAATATAGTTTGGAAGCAGAGTTGCAGGATATCTTCCCTACAGAAATCACCCAGACTCGGAGATCAGCACCGGTATCTCCTCGGGGTAGCCCAAGTGACAGCCGACAAATACCACTTCAACAGTACAACAACCCTTCAAAGCTCTACACAAACAACAACAACATAGAAGCAAACTTGTCATCACATATGGCAAGAATCAATCTCTCTTCCCCGCAGAGTGTTGATCCCTTCAGATCAGTCCCAAAAAGCAAGAATGGGATAGATACGGAATCAGATGTGTACAAGATGCTTCAGGATTACGTAGAGCCTGTGTCACAACCCAAGCAGTCTGGATCGTTCAAGTACTTGCAGGACATGTTGGAAGCCGGAGAGAATGGTGAAAAGCCGGAAAGGCCGCCCAGCTCCAGAAACATAAAATCACCAGTGTCTAAACTGAGCAGCCCCTTGCCTGGCCTGCAGATGCTCCCTCAGTGCACCAGATGTGGGAATGGCATTGTTGGCACCATAGTGAAGGCGCGAGACAAGCTCTACCACCCAGAATGCTTTATGTGTGACGACTGCGGCCTAAACCTGAAGCAGAGGGGATACTTCTTCATTGAAGAGCAGTTATACTGCGAAACCCACGCCAAGGAGAGAGTCAAGCCGCCTGAAGGATATGATGTTGTTGCTGTGTATCCCAACGCCAAGGTGGAACTCGTCTAA
Full Trace Sequence: gtagtttcagtgcggtgcatgaacagtacccggggagcagcacagccgccagctcctgcccagcattccgtgcgtgcgagggaaaggaacaagggatacaatgttcctcagcgtcactctcagtggcccttcaccctggggatttaggctggtggggggcagggactacaacacccctctgactatttcaaagattaaccctgggagcaaggcggaattggctaacctgtatccaggagatgttatcctggaaatcaatggggagaacacggagaacatgaatcacctagttgctcaaaacaagattaaggcctgcacagatcaactgatgctttccataaacagacgtgatggaagaaccttgttaaatgaagaagaactgaaaaggcagcaacgtaaatatagtttggaagcagagttgcaggatatcttccctacagaaatcacccagactcggagatcagcaccggtatctcctcggggtagcccaagtgacagccgacaaataccacttcaacagtacaacaacccttcaaagctctacacaaacaacaacaacatagaagcaaacttgtcatcacatatggcaagaatcaatctctcttccccgcagagtgttgatcccttcagatcagtcccaaaaagcaagaatgggatagatacggaatcagatgtgtacaagatgcttcaggattacgtagagcctgtgtcacaacccaagcagtctggatcgttcaagtacttgcaggacatgttggaagccggagagaatggtgaaaagccggaaaggccgcccagctccagaaacataaaatcaccagtgtctaaactgagcagccccttgcctggcctgcagatgctccctcagtgcaccagatgtgggaatggcattgttggcaccatagtgaaggcgcgagacaagctctaccacccagaatgctttatgtgtgacgactgcggcctaaacctgaagcagaggggatacttcttcattgaagagcagttatactgcgaaacccacgccaaggagagagtcaagccgcctgaaggatatgatgttgttgctgtgtatcccaacgccaaggtggaactcgtctaaccagccgcataatcacgaatccatggataggtctgtgccgtcgcattgcttaaagggccactaaacctaaaatactcagcggcccataaggaaaaactcacattttgaatctttgacaaagaatatgtaaaagttcctattcctttacaaaataagtgacattaaataaacccttgctcattcatgcagggcaggaaatctgatgtgcatggatgaattctttcccccgagatcacagccttttctcaaatatgttgagtttaacaagctactaaagtgttatatatatatatatatatttgtcagagttgcccctagctcttcttcttaagatattctgcaatgtagtgttccttaaaaataatgatgttctcgtatttatatgtgccttgcggacagtgccaggacccccttacatccattcctccccatcagcctgactatacaatggctacagtctcatatagagaaatggcaataatgggcaactccactaaggaatgaaggttgtgcgtctgactttgtgaggccactaatacagttttccctaccctagtctgggggtaccccagctccttagtgcaacaaaaccctcctgtatctgatacacacagacacaaacaatgacacacacactgacacacaggcacatacacactgacacacaggcacatacacactgacacacaggcacacacacagtcacacacacacccagacacatacatagtcacacacaggcacacacagacaagactcagccacgttactgagacttcacaatattcatttttgcttacataaccatttagatgaaactgtaatgttattaacatttattgtccatctgttctcgcatttgtactttttgcacatgtcttggtttaacccaagaggttacagcatcagtctggcaccaagcaatatcctttgtaaataataagttgctttcaactcctgctccaataaaaataccatttctttttagtaaaaaaaaaaaaaaaaa
Translation: MFLSVTLSGPSPWGFRLVGGRDYNTPLTISKINPGSKAELANLYPGDVILEINGENTENMNHLVAQNKIKACTDQLMLSINRRDGRTLLNEEELKRQQRKYSLEAELQDIFPTEITQTRRSAPVSPRGSPSDSRQIPLQQYNNPSKLYTNNNNIEANLSSHMARINLSSPQSVDPFRSVPKSKNGIDTESDVYKMLQDYVEPVSQPKQSGSFKYLQDMLEAGENGEKPERPPSSRNIKSPVSKLSSPLPGLQMLPQCTRCGNGIVGTIVKARDKLYHPECFMCDDCGLNLKQRGYFFIEEQLYCETHAKERVKPPEGYDVVAVYPNAKVELV
Donor tissue: tailbud