ORFeome > peli1 – XORFeome 2.0

peli1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis pellino homolog 1 (Drosophila), mRNA (cDNA clone MGC:75650 IMAGE:5379633), complete cds
Gene Symbol: peli1
Gene ID: 394778
ORF gb_acc: MG132839
ORF ID: 10190

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC063200

Library Location

Plate ID: GDExt11002
Well Location: C08

EST Sequences

Clone: MGC:75650 IMAGE:5379633
Trimmed Sequence: ATGTTTTCCCCCAGTCAGGAGGAGCACTGCGCCCCCAGTAAGGAGCCCGTCAAATACGGAGAGCTGGTGGTGCTGGGGTACAACGGCTGTCTCCCAAATGGGGATCGAGGAAGGCGGAAAAGCAGATTTGCACTCTTTAAACGCCCTAAATCCAATGGGGTGAGAGCCAGCAGTGTCCATGTGATTTCAACCCCACAGGCTTCCAAGGCAATCAGCAGCAGAGGCCAACACAGCATCTCATTCACATTATCCAGAAGTCAGACTGTTGTGGTGGAATACACCCATGACAAGGACACAGATATGTTTCAGATTGGAAGGTCAACAGAAAGTCCCATTGACTTTGTAGTAACTGACACGGTTTCTGGCAACCAGAATGATGAAACACAGATAACACAAAGTACAATCTCTAGATTTGCGTGCAGGATAGTCTGTGACAGGAACCCTCCGTACACCGCTAGAATATTTGCTGCAGGATTTGACTCCTCCAAAAATATATTTCTTGGTGAGAAAGCGGCCAAGTGGAAGAATCCTGATGGTCATATGGATGGACTAACTACCAATGGTGTTCTTGTGATGCATCCGAAGGGAGGGTTTACTGAAGAATCCAGGCCTGGAGTATGGCGGGAAATTTCAGTCTGTGGAGATGTATATACATTAAGAGAAACCAGATCTGCTCAGCAAAGAGGCAAACTTGTGGAAAATGAAACCAATATTCTGCAGGATGGTTCTCTTGTTGACTTATGTGGTGCCACCCTTCTTTGGCGAACAGCAGATGGTTTGCTCCATACACCGACTCAAAAACACATTGAAGCTTTGAGACTGGAAATAAATGCTGCCAGGCCTCAGTGCCCTGTTGGATTAAACACTTTAGCTTTTCCCAGTATCAACCGCAAAGATGTCGTAGAAGAGAAACAGCCTTGGGCTTACCTCACCTGTGGTCATGTGCACGGCTATCATAACTGGGGTCATCGCAGTGACACAGAAGTCAATGAACGCGAGTGTCCCATGTGTAGAACAGTTGGTCCCTATGTGCCTCTATGGCTTGGTTGTGAAGCAGGATTCTACGTAGATGCTGGACCTCCTACTCACGCTTTCAAACCTTGTGGACACGTCAGCTCAGAAAAATCTGCCAAATATTGGTCTCAGATTCCACTGCCACATGGTACACACGCGTTTCATGCTGCTTGTCCTTTCTGCGCAATACAATTGACTGGAGAAGAAAGCTGTGTCAAACTTATTTTCCAGGGCCCTGTTGACTAA
Full Trace Sequence: cgcgtcggttgcagggcaggaggcagacgcaagcggcttgttcctcgggagtgctgctgttttgctttgggctgccggagacaggccgcggcgctttggagggattataacctttcccgtcagctggagctggaagaaactactggggagggaggggagagtgcggcggtgacagtaatctgcgccacagggcagcctctttgctcctaggatttatccgccacccgggctggtgagctgcggcatccggtgtgtatatgagctgccatggagtagagggggtgcggaagtggagctccccgagggattgtacggctggccggggaccgtgcattggcagagggtgacggggaccgtcttctccatgttttcccccagtcaggaggagcactgcgcccccagtaaggagcccgtcaaatacggagagctggtggtgctggggtacaacggctgtctcccaaatggggatcgaggaaggcggaaaagcagatttgcactctttaaacgccctaaatccaatggggtgagagccagcagtgtccatgtgatttcaaccccacaggcttccaaggcaatcagcagcagaggccaacacagcatctcattcacattatccagaagtcagactgttgtggtggaatacacccatgacaaggacacagatatgtttcagattggaaggtcaacagaaagtcccattgactttgtagtaactgacacggtttctggcaaccagaatgatgaaacacagataacacaaagtacaatctctagatttgcgtgcaggatagtctgtgacaggaaccctccgtacaccgctagaatatttgctgcaggatttgactcctccaaaaatatatttcttggtgagaaagcggccaagtggaagaatcctgatggtcatatggatggactaactaccaatggtgttcttgtgatgcatccgaagggagggtttactgaagaatccaggcctggagtatggcgggaaatttcagtctgtggagatgtatatacattaagagaaaccagatctgctcagcaaagaggcaaacttgtggaaaatgaaaccaatattctgcaggatggttctcttgttgacttatgtggtgccacccttctttggcgaacagcagatggtttgctccatacaccgactcaaaaacacattgaagctttgagactggaaataaatgctgccaggcctcagtgccctgttggattaaacactttagcttttcccagtatcaaccgcaaagatgtcgtagaagagaaacagccttgggcttacctcacctgtggtcatgtgcacggctatcataactggggtcatcgcagtgacacagaagtcaatgaacgcgagtgtcccatgtgtagaacagttggtccctatgtgcctctatggcttggttgtgaagcaggattctacgtagatgctggacctcctactcacgctttcaaaccttgtggacacgtcagctcagaaaaatctgccaaatattggtctcagattccactgccacatggtacacacgcgtttcatgctgcttgtcctttctgcgcaatacaattgactggagaagaaagctgtgtcaaacttattttccagggccctgttgactaatgttatttataagagctgataacaattttgttaataaaaaaaaatctaaaaaaaaaaaaaatactgtgaagttttcaccactaatattagaatttaccttttttataattttattaatggggagcaaattattccagtgtcttggaatagatctgatgtcaatgctttggcatgcataccagcagcttattcattgaagctattgatttcttttttttttgtctagattgttatgtttgtaaatcactttaatacaaatccttgtttgaaagaggaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MFSPSQEEHCAPSKEPVKYGELVVLGYNGCLPNGDRGRRKSRFALFKRPKSNGVRASSVHVISTPQASKAISSRGQHSISFTLSRSQTVVVEYTHDKDTDMFQIGRSTESPIDFVVTDTVSGNQNDETQITQSTISRFACRIVCDRNPPYTARIFAAGFDSSKNIFLGEKAAKWKNPDGHMDGLTTNGVLVMHPKGGFTEESRPGVWREISVCGDVYTLRETRSAQQRGKLVENETNILQDGSLVDLCGATLLWRTADGLLHTPTQKHIEALRLEINAARPQCPVGLNTLAFPSINRKDVVEEKQPWAYLTCGHVHGYHNWGHRSDTEVNERECPMCRTVGPYVPLWLGCEAGFYVDAGPPTHAFKPCGHVSSEKSAKYWSQIPLPHGTHAFHAACPFCAIQLTGEESCVKLIFQGPVD
Donor tissue: tailbud