ORFeome > pfkp – XORFeome 2.0

pfkp – XORFeome 2.0

General Information

Species: Xenopus tropicalis phosphofructokinase, platelet, mRNA (cDNA clone MGC:75635 IMAGE:5379460), complete cds
Gene Symbol: pfkp
Gene ID: 394825
ORF gb_acc: MG132858
ORF ID: 10212

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC063195

Library Location

Plate ID: GDExt11003
Well Location: C05

EST Sequences

Clone: MGC:75635 IMAGE:5379460
Trimmed Sequence: ATGGCACAGCCAGATAGGAAGCTTTTCGAGAATCTGTCCGGGAAGGGCAAAGCCATCGGGGTGCTGACCAGCGGAGGAGATGCCCAAGGTATGAACGCAGCTGTGCGCGCCGTAGTGCGAATGGGCATCTACGTACAAGCCAAAGTGTACTTCATTTATGAGGGCTACCAAGGAATGGTGGATGGCGGAGACAACATTGAGGAAGTGTCATGGGAAAGCGTTTCTAGCATCTTGCAAGTGGGTGGGACCGTCATTGGTAGTGCGCGTTGCAAGGCATTCCGGACTCGCGAAGGACGTTTGCAGGCAGCTTATAACCTTGTTCAACGTGGAATTACCAATCTGTGTGTTATTGGCGGTGATGGCAGTCTGACAGGTGCTAACCTGTTCCGTGAGGAATGGAGCGGGCTTCTTGATGAACTAATGCAAAATGGAAAAATTGAGGCAGAAGCAACCAGGGAATATGCCCATCTGAACATTGTAGGAATGGTGGGATCTATAGATAATGATTTCTGTGGAACTGATATGACCATTGGGACCGACTCTGCCCTGCATAGGATTATTGAAGTGGTTGATGCTATCATGACCACAGCTCAGAGCCACCAGAGGACCTTTGTGCTGGAAGTTATGGGAAGACACTGTGGGTACCTCGCTCTGGTCAGTGCCTTAGCTTGTGGGGCAGACTGGGTGTTTATCCCTGAATACCCTCCGGAAGAGGGATGGGAAGACATGATGTGCAACAAACTGTCTGAGAATCGTGCAAGGAAGAAAAGGCTTAATATCATCATTGTATCAGAAGGAGCTATCGACTGCCATAATAAGGCAATCACGTCAGACATGGTTAAGGATCTTGTTGTGAAACGCCTGGGGTTTGACACCCGTGTTACAATATTGGGCCATGTCCAAAGAGGTGGAACCCCATCAGCTTTTGACAGGATTCTGGCAAGTCGAATGGGAGTGGACTGTGTGTTGGCCCTGCTTGAAGCTACGCCAGAAACGCCAGCCTGTGTTGTGTCGTTATGTGGAAACCAAGCTGTGCGACTGCCCCTTATGGAATGTGTTCAGATGACCCAGGAAGTGCAGAAGGCCATGGATGAAAGAAGATTTGATGATGCTGTAAGGTTACGGGGAAGGAGCTTTGAAAATAACCTAAACACTTACAAGCTGCTCTCCCATAAGAAAAATGTAGCAGACCTTCCAAAGAGTAATTTCACCGTGGCCGTTCTGAATGTGGGGGCACCGGCTGCGGGCATGAACGCTGCAGTCAGATCTGCGGTGAGAGTAGGAATAACTGAAGGCCACAAAATGCTAGCCGTCAATGATGGTTTTGAAGGATTCGCCAAGGGGCAGATTAAAGACATAAAATGGGGAGATGTTGGTGGCTGGACTGGTCAAGGCGGATCTCTTCTGGGAACAAAGAGGACCCTTCCTGCTAAATACTTTGACAAAATTGCAGAGCAAATCCGAACGCATAAAATTAACGCTCTCCTTGTCATTGGTGGATTTGAGGCCTACTTGGGACTGATGGAAATGGTTGAGGGCCGAGGGAAGTATGATGAGTTCTGTATCCCTATGGTCATGGTTCCCGCTACTGTCTCCAACAATGTGCCCGGCTCAGATTTCAGCATTGGTGCAGATACAGCTCTGAACACTATAACCGATACGTGCGATCGCATCAAACAGTCAGCGAGTGGAACCAAACGGCGGGTCTTCATCATTGAAACCATGGGTGGCTACTGCGGCTACTTGGCTAACATGGGCGGCCTCGCGGCCGGTGCAGATGCGGCGTACATCTTTGAAGAATCCTTTGATATTCGGGAGCTCCAGGCAAATGTGGAACATTTAACAGAGAAGATGAAAACAAGCATCCAAAGAGGTCTGGTACTGAGGCCTCGCCTATTCATAGATCAGCCTCCCATTCAAACCACTCCCCGGTTGTTAAGAAATGAGAACAGCAATGAGAACTACACGACAGATTTCATTTATCAGCTTTACTCGGAGGAAGGCAGAGGCGTGTTTGACTGCAGAAAGAATGTATTGGGCCACATGCAGCAGGGTGGCGCTCCTTCCCCGTTCGACAGAAACTTCGGCACTAAAATTTCCGCCAAAGCCGTTCAGTGGATTTCCAAGAAGTTAAAAGAAACCTACAGGAAAGGCAGGGTATTCGCCAACACGGACGACAGCGTTTGCCTGTTAGGAATGCGCAGGAGGAACCTTCTTTTCCAGCCAGTTACACAACTCAAGGACGAAACAGACTTCAAGCACAGGATTCCCAAGGAACAGTGGTGGCTGAAGATGAGGCCTTTGATGAAGATTCTGGCCAAGTACAAGACAAGCTACGACATTTCAGACGCCGGGAAGCTGGAACACGTGAACATGTGCAGACGGAAAGATGAAACGGGACCCATCTGA
Full Trace Sequence: ggcaaggggaacggtgcagtttccccatcgcagccttcattatatttattcacagtatatttattttttcatataggcacagagtgtgtatatatatatagctatatttattcatagagtatagtgcggagagtggcaatcatggcacagccagataggaagcttttcgagaatctgtccgggaagggcaaagccatcggggtgctgaccagcggaggagatgcccaaggtatgaacgcagctgtgcgcgccgtagtgcgaatgggcatctacgtacaagccaaagtgtacttcatttatgagggctaccaaggaatggtggatggcggagacaacattgaggaagtgtcatgggaaagcgtttctagcatcttgcaagtgggtgggaccgtcattggtagtgcgcgttgcaaggcattccggactcgcgaaggacgtttgcaggcagcttataaccttgttcaacgtggaattaccaatctgtgtgttattggcggtgatggcagtctgacaggtgctaacctgttccgtgaggaatggagcgggcttcttgatgaactaatgcaaaatggaaaaattgaggcagaagcaaccagggaatatgcccatctgaacattgtaggaatggtgggatctatagataatgatttctgtggaactgatatgaccattgggaccgactctgccctgcataggattattgaagtggttgatgctatcatgaccacagctcagagccaccagaggacctttgtgctggaagttatgggaagacactgtgggtacctcgctctggtcagtgccttagcttgtggggcagactgggtgtttatccctgaataccctccggaagagggatgggaagacatgatgtgcaacaaactgtctgagaatcgtgcaaggaagaaaaggcttaatatcatcattgtatcagaaggagctatcgactgccataataaggcaatcacgtcagacatggttaaggatcttgttgtgaaacgcctggggtttgacacccgtgttacaatattgggccatgtccaaagaggtggaaccccatcagcttttgacaggattctggcaagtcgaatgggagtggactgtgtgttggccctgcttgaagctacgccagaaacgccagcctgtgttgtgtcgttatgtggaaaccaagctgtgcgactgccccttatggaatgtgttcagatgacccaggaagtgcagaaggccatggatgaaagaagatttgatgatgctgtaaggttacggggaaggagctttgaaaataacctaaacacttacaagctgctctcccataagaaaaatgtagcagaccttccaaagagtaatttcaccgtggccgttctgaatgtgggggcaccggctgcgggcatgaacgctgcagtcagatctgcggtgagagtaggaataactgaaggccacaaaatgctagccgtcaatgatggttttgaaggattcgccaaggggcagattaaagacataaaatggggagatgttggtggctggactggtcaaggcggatctcttctgggaacaaagaggacccttcctgctaaatactttgacaaaattgcagagcaaatccgaacgcataaaattaacgctctccttgtcattggtggatttgaggcctacttgggactgatggaaatggttgagggccgagggaagtatgatgagttctgtatccctatggtcatggttcccgctactgtctccaacaatgtgcccggctcagatttcagcattggtgcagatacagctctgaacactataaccgatacgtgcgatcgcatcaaacagtcagcgagtggaaccaaacggcgggtcttcatcattgaaaccatgggtggctactgcggctacttggctaacatgggcggcctcgcggccggtgcagatgcggcgtacatctttgaagaatcctttgatattcgggagctccaggcaaatgtggaacatttaacagagaagatgaaaacaagcatccaaagaggtctggtactgaggcctcgcctattcatagatcagcctcccattcaaaccactccccggttgttaagaaatgagaacagcaatgagaactacacgacagatttcatttatcagctttactcggaggaaggcagaggcgtgtttgactgcagaaagaatgtattgggccacatgcagcagggtggcgctccttccccgttcgacagaaacttcggcactaaaatttccgccaaagccgttcagtggatttccaagaagttaaaagaaacctacaggaaaggcagggtattcgccaacacggacgacagcgtttgcctgttaggaatgcgcaggaggaaccttcttttccagccagttacacaactcaaggacgaaacagacttcaagcacaggattcccaaggaacagtggtggctgaagatgaggcctttgatgaagattctggccaagtacaagacaagctacgacatttcagacgccgggaagctggaacacgtgaacatgtgcagacggaaagatgaaacgggacccatctgaacttcatgcccaaacctattgttatcgcctatctacattgtgtgctgtagcgccatagtctgtcacttgcctattgctatttattgctccagcactttctgtccatccggtttccattgcgaggcccgcgcagccccagtaccatctatacatatctctccagcccagacccacgcagccccaataccatctatacgtatctctccagcccaggcccgcgcagcccctgtaccatctatacatatctgtgtaaatgccacacccacctgtattccaacccattttactccggctccaatattccacatattgcctttatgagtaaaatgggacaacaaaaaccccccaacatttggaaacgttcctgctgcgtagttgagttctgcttctattccactttgtaccagagacgtaatgattccacacgtacaatcaatgtgcaatgtttggatttttgtttttttagtgacaagttatatatgttggtgtaaaatcacaaaaataaaaaaaaaaactcgcaaaccaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MAQPDRKLFENLSGKGKAIGVLTSGGDAQGMNAAVRAVVRMGIYVQAKVYFIYEGYQGMVDGGDNIEEVSWESVSSILQVGGTVIGSARCKAFRTREGRLQAAYNLVQRGITNLCVIGGDGSLTGANLFREEWSGLLDELMQNGKIEAEATREYAHLNIVGMVGSIDNDFCGTDMTIGTDSALHRIIEVVDAIMTTAQSHQRTFVLEVMGRHCGYLALVSALACGADWVFIPEYPPEEGWEDMMCNKLSENRARKKRLNIIIVSEGAIDCHNKAITSDMVKDLVVKRLGFDTRVTILGHVQRGGTPSAFDRILASRMGVDCVLALLEATPETPACVVSLCGNQAVRLPLMECVQMTQEVQKAMDERRFDDAVRLRGRSFENNLNTYKLLSHKKNVADLPKSNFTVAVLNVGAPAAGMNAAVRSAVRVGITEGHKMLAVNDGFEGFAKGQIKDIKWGDVGGWTGQGGSLLGTKRTLPAKYFDKIAEQIRTHKINALLVIGGFEAYLGLMEMVEGRGKYDEFCIPMVMVPATVSNNVPGSDFSIGADTALNTITDTCDRIKQSASGTKRRVFIIETMGGYCGYLANMGGLAAGADAAYIFEESFDIRELQANVEHLTEKMKTSIQRGLVLRPRLFIDQPPIQTTPRLLRNENSNENYTTDFIYQLYSEEGRGVFDCRKNVLGHMQQGGAPSPFDRNFGTKISAKAVQWISKKLKETYRKGRVFANTDDSVCLLGMRRRNLLFQPVTQLKDETDFKHRIPKEQWWLKMRPLMKILAKYKTSYDISDAGKLEHVNMCRRKDETGPI
Donor tissue: tailbud