ORFeome > pinx1 – XORFeome 2.0

pinx1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis shelterin accessory factor, mRNA (cDNA clone MGC:89170 IMAGE:7016313), complete cds
Gene Symbol: pinx1
Gene ID: 448337
ORF gb_acc: MG134210
ORF ID: 11863

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC075416

Library Location

Plate ID: GDExt11018
Well Location: A04

EST Sequences

Clone: MGC:89170 IMAGE:7016313
Trimmed Sequence: ATGGCAATGCTGGCAGAGCCCCGTAGGAAACAGAAATGGTCGGTAGACCCAAGAAACAGCGCCTGGAGTAAGGATGAGTCCAAATTTGGCCAGAAGATGCTGGAAAAGATGGGCTGGTCCAAAGGCAAGGGGCTGGGAGCTAAGGAACAAGGGAGCACAGACCACATCAAGGTGCAAGTAAAGAACAACACTCTGGGACTCGGAGCCTCTATCAACTATGAGGATAACTGGCTCTCCCATCAGGATGATTTTAACCAGATTCTGGCTGAGCTGAATAACTGCCATGGGACAGACTCCGAAGAGACTCCGGCTGAGCAAGAGAAGAAATCATTTAGCCTGGAAGAGAAGTCCAAATCCTCTAGGAAGCGCGTCCATTACATGAAATTCGCCAAAGGGAAGGACCTCTCGTGCCGCAGCGCCACTGACCTCGCCTGTATCTTTGGGAAGCGGGAGAAGGCTAAGAAGGGAGCCCCCCTGCAGGAAGAAGCTTCAGTTGAGTCTGAGGGAAATGAGGAAGAGGAAACGGGAAAGCAAAGCCCCTCAATAGAAACCCCCCCAGGAAACACTGTGACGAGCTCCCTGTCAGTAAATGAGTATTTTGCAAAGCGAATGGCAGAACTGAAGAGGTCTCAGTCGAAACGCACAGAGCAACTTACACAGGAAGAGGAGGTACTTAATGAAGAAGAACCCGACGAGAGCTCTACAGAGAGAAACCAGAAGCCCAACAAGAGGAAACGCAACAAGGGCGACGCCATGACTGACATGGAAAATACGGACTCTCCGTGTGTCACAGAAAGGCCACAATCAAAGAAAAAATCAAAGAATAAAAAATATCAGGAGACTGAATATGAGACTGGTGGAACTAAAGATGAGGAGGATGAAGAGGAGAAACCGAAAAAACGAAAAAAGAAAAATAAGAAGAGGAAGGATGAACCCCACGGGGAGGAGGAGGAGGAGTTAGACTCTCACACACAGCCGGCAAAGAAGAAGAAGAAGAAAAAGAAGTCTGAATAA
Full Trace Sequence: cagctgtgccctgaggaacatctatcccggtcagggcttccagctccgggaccatggcaatgctggcagagccccgtaggaaacagaaatggtcggtagacccaagaaacagcgcctggagtaaggatgagtccaaatttggccagaagatgctggaaaagatgggctggtccaaaggcaaggggctgggagctaaggaacaagggagcacagaccacatcaaggtgcaagtaaagaacaacactctgggactcggagcctctatcaactatgaggataactggctctcccatcaggatgattttaaccagattctggctgagctgaataactgccatgggacagactccgaagagactccggctgagcaagagaagaaatcatttagcctggaagagaagtccaaatcctctaggaagcgcgtccattacatgaaattcgccaaagggaaggacctctcgtgccgcagcgccactgacctcgcctgtatctttgggaagcgggagaaggctaagaagggagcccccctgcaggaagaagcttcagttgagtctgagggaaatgaggaagaggaaacgggaaagcaaagcccctcaatagaaacccccccaggaaacactgtgacgagctccctgtcagtaaatgagtattttgcaaagcgaatggcagaactgaagaggtctcagtcgaaacgcacagagcaacttacacaggaagaggaggtacttaatgaagaagaacccgacgagagctctacagagagaaaccagaagcccaacaagaggaaacgcaacaagggcgacgccatgactgacatggaaaatacggactctccgtgtgtcacagaaaggccacaatcaaagaaaaaatcaaagaataaaaaatatcaggagactgaatatgagactggtggaactaaagatgaggaggatgaagaggagaaaccgaaaaaacgaaaaaagaaaaataagaagaggaaggatgaaccccacggggaggaggaggaggagttagactctcacacacagccggcaaagaagaagaagaagaaaaagaagtctgaataaatccaaacaactattgaaaaaatgtctcttgttgctatggaagccgccgtatcttactgttagaatcttgcagctgtaatggagccgctgtaggtttatgggatattagcgatttctatagataaacttacacccaaataaatcaacttttcatattatgtaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MAMLAEPRRKQKWSVDPRNSAWSKDESKFGQKMLEKMGWSKGKGLGAKEQGSTDHIKVQVKNNTLGLGASINYEDNWLSHQDDFNQILAELNNCHGTDSEETPAEQEKKSFSLEEKSKSSRKRVHYMKFAKGKDLSCRSATDLACIFGKREKAKKGAPLQEEASVESEGNEEEETGKQSPSIETPPGNTVTSSLSVNEYFAKRMAELKRSQSKRTEQLTQEEEVLNEEEPDESSTERNQKPNKRKRNKGDAMTDMENTDSPCVTERPQSKKKSKNKKYQETEYETGGTKDEEDEEEKPKKRKKKNKKRKDEPHGEEEEELDSHTQPAKKKKKKKKSE
Donor tissue: