ORFeome > pip5k1b – XORFeome 2.0

pip5k1b – XORFeome 2.0

General Information

Species: Xenopus tropicalis phosphatidylinositol-4-phosphate 5-kinase, type I, beta, mRNA (cDNA clone MGC:69425 IMAGE:5335651), complete cds
Gene Symbol: pip5k1b
Gene ID: 448746
ORF gb_acc: MG133267
ORF ID: 10751

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC074662

Library Location

Plate ID: GDExt11008
Well Location: H03

EST Sequences

Clone: MGC:69425 IMAGE:5335651
Trimmed Sequence: ATGGCATCAGCGGCTGCCGAGCCAGCGGGAGGCACAAGCCCAGGGACGACCACTCTGAAGAAATCCATGGTGGCCGAGGTACCCGGCTCTTCTGCGCAGCCCGGGGCACAGACAATGAAGAAAATTGGGCACAGAGGTGTCGACTCAACTGGCGAGACTACATACAAAAAGACCACGTCATCTGCTCTGAAAGGTGCCATCCAGCTTGGCATCACTCACACCGTGGGCAGTCTGAGCACCAAGCCCGAGAGAGATGTACTCATGCAGGACTTCTACGTGGTGGAGAGTATCTTCTTCCCAGGTGAGGGCAGCAATCTGACTCCCGCCCATCATTACAATGACTTCCGCTTCAAAACCTACGCCCCCGTCGCCTTCCGCTACTTCAGAGAGCTCTTCAGCATTCGCCCCGATGACTACCTGTATTCTCTGTGCAACGAGCCGCTCATTGAGTTGTCCAACCCCGGTGCCAGCGGTTCCGTGTTTTACGTGTCTGGGGATGACGAGTTCATTATAAAGACGGTCCAACACAAGGAGGCGGAGTTTCTCCAGAAGCTGCTGCCTGGTTACTACATGAACCTTAATCAGAACCCTAGAACTCTGCTGCCCAAGTTCTATGGCTTGTACTGTGTCCAGGCCGGGGGCAAGAACATTCGAATAGTGGTCATGAACAATCTGCTGCCCCGCTCCGTCAGAATGCACCTCAAGTACGACCTTAAGGGCTCCACGTACAAGCGCCGCGCTTCCGCCAAAGAACGGGAGAAGAAGTCCCCGACTTACAAGGACTTGGACTTCTTGCAGGACTTGCCCGACGGTCTCTTCCTCGACCCTGATATGCACAACGCTCTTTGCAAGACAATCCAGAGGGACTGTCTGGTGCTCCAGAGCTTTAAGATCATGGACTACAGTTTACTGGTGGGAGTCCACAACATGGACTGTGCGCAGAAGGAGACGGCAGTGGACGGACACACCCAGAGCGACACGCGCCGCCCCGCTGCACAGAAGGCACTCTATTCAACCGCCATGGAGTCTATTCAGGGAGAGGCGCGGCGAGGGGGCGCCATAGAGACAGACGACCAAATGGGTGGGATTCCCGCTCGCAACGCCAAAGGAGAACGCCTGTTGCTCTACATCGGTGTCATTGACGTGCTACAATCGTACAGGTTCATGAAGAAACTGGAGCACTCTTGGAAGGCCCTGGTGCACGACGGGGACACCGTGTCGGTTCACAGGCCCGGATTCTACGCCGACAGGTTCCAGAAGTTCATGTGCAGCATCGTCTTCAAGAAGATCCCACTAAAAACCTCTCCCTCCAAGAAGAGCCGTACGATGCCCGGTGTGTCTCGGAGGGCCACCCAGGCAGCAGTACCGACCCAGTTGCAGCTGGTGGAAGAGCATAAGCAGTATCTAGCGACTGAAGTTGAATCAGAACCAGGGAGTCAGTTTGGTCGCCCCGACCTCCTTCCTCGAACCCCTCCTGTCGATGAAGCAGCTAGTGACTCATTGGCCACCACCTTATCCACCTCCTCGCTGGGCAGCGGAGGGCTGAACTCTCCGGCACACAGGTCTGTGGGGGTGGAAGTGCACAAAGTCGAAACGACGGAGATCGAGTTAAACGCAGTGAGAAGCGAAGTACTAGACGAATCCAATCAAGAAGATGAAGCAGGAGGAGAAGAGGAAGAAGAGGAGGCTCTGGACATCAGCCAGATCGAGACAGAGATCCGCTTTTGA
Full Trace Sequence: gtgagtgtgagtggggggagccggcgggcaggatgagagccgagtagcgggagggacatccctgccggagtgtgagagcaggggggccggtaacccgagtgagtgcagcccggccgggcccccctccaaacaccgccgggacagaagcttcccccccaggggcgataccgggagcccggagccactcacaccggaaccggccggatagcggccccaccatcctgagacccgagccgctctctcctcactgctcctgcccgggccgaaatggcatcagcggctgccgagccagcgggaggcacaagcccagggacgaccactctgaagaaatccatggtggccgaggtacccggctcttctgcgcagcccggggcacagacaatgaagaaaattgggcacagaggtgtcgactcaactggcgagactacatacaaaaagaccacgtcatctgctctgaaaggtgccatccagcttggcatcactcacaccgtgggcagtctgagcaccaagcccgagagagatgtactcatgcaggacttctacgtggtggagagtatcttcttcccaggtgagggcagcaatctgactcccgcccatcattacaatgacttccgcttcaaaacctacgcccccgtcgccttccgctacttcagagagctcttcagcattcgccccgatgactacctgtattctctgtgcaacgagccgctcattgagttgtccaaccccggtgccagcggttccgtgttttacgtgtctggggatgacgagttcattataaagacggtccaacacaaggaggcggagtttctccagaagctgctgcctggttactacatgaaccttaatcagaaccctagaactctgctgcccaagttctatggcttgtactgtgtccaggccgggggcaagaacattcgaatagtggtcatgaacaatctgctgccccgctccgtcagaatgcacctcaagtacgaccttaagggctccacgtacaagcgccgcgcttccgccaaagaacgggagaagaagtccccgacttacaaggacttggacttcttgcaggacttgcccgacggtctcttcctcgaccctgatatgcacaacgctctttgcaagacaatccagagggactgtctggtgctccagagctttaagatcatggactacagtttactggtgggagtccacaacatggactgtgcgcagaaggagacggcagtggacggacacacccagagcgacacgcgccgccccgctgcacagaaggcactctattcaaccgccatggagtctattcagggagaggcgcggcgagggggcgccatagagacagacgaccaaatgggtgggattcccgctcgcaacgccaaaggagaacgcctgttgctctacatcggtgtcattgacgtgctacaatcgtacaggttcatgaagaaactggagcactcttggaaggccctggtgcacgacggggacaccgtgtcggttcacaggcccggattctacgccgacaggttccagaagttcatgtgcagcatcgtcttcaagaagatcccactaaaaacctctccctccaagaagagccgtacgatgcccggtgtgtctcggagggccacccaggcagcagtaccgacccagttgcagctggtggaagagcataagcagtatctagcgactgaagttgaatcagaaccagggagtcagtttggtcgccccgacctccttcctcgaacccctcctgtcgatgaagcagctagtgactcattggccaccaccttatccacctcctcgctgggcagcggagggctgaactctccggcacacaggtctgtgggggtggaagtgcacaaagtcgaaacgacggagatcgagttaaacgcagtgagaagcgaagtactagacgaatccaatcaagaagatgaagcaggaggagaagaggaagaagaggaggctctggacatcagccagatcgagacagagatccgcttttgagctgggattggccacggctgctttctttacggtggctcagcagggccacaaaaagatttgcccgcttcgtttgcaccaaactaccctggaggcaacatcagtgacacaactgggtttggacgaggggatcccgttggctccgagaggcggtgtgcctggcgctgatgttccaagcagaccattggctgctccccagcagggcgggccacaagtgaataaactcctcccatttgccttattctgcagtccctttatgagaggagcttcctttccctcctatttaagagatatttttctgctcgtgtgtagaactccgatgctgcatttacggaccaaaagatttttttgtacaagcatttgctgcctaagtcaccataacggacgtggtgccgccggggcccgacatgagcgcccccttgtgacagggtggttatggacaatatgtgtgtgttttgcacagactgctggtgttctctatacaatgacagcccaaccaaatctctccctgtgccaatgcccgtgccgcggcaccgctcgtattgtgtggcgctaatttctgatgcggtttcctcatgctcttaccccccccgtgggggcaataacgattgtgagattcacgtggaatcctgctcctctccattacggatgggcagccctccagccattgctacactacagcctacagagagcagcagttcagcaccagcagggggggctgccggttacccctcccttacttgcaccctaaattccagtgaacatgtggagggggaagtgggggtgagcttgtgatgggggggttctctgtgctgctaaactgcaaaataaaagtgagaggtggatccctagtgcgctggtgtgtgagggcatcgtgggtattgcacgggggtaataacggccttaaggtgcccctggggggggttgcacagatctgcctgtgccccaaacactatttataaatgcccctcccgtgcagcccggctgattttatcatttgaaccttttattcccatttcgttgagattttttttccttcacgttgtcttttaatatttatgaaagtttttatttaactgttttatttccgaatccaagtgctttgtgcaggcgctgcctccctgtatgtacataaactataacccccaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MASAAAEPAGGTSPGTTTLKKSMVAEVPGSSAQPGAQTMKKIGHRGVDSTGETTYKKTTSSALKGAIQLGITHTVGSLSTKPERDVLMQDFYVVESIFFPGEGSNLTPAHHYNDFRFKTYAPVAFRYFRELFSIRPDDYLYSLCNEPLIELSNPGASGSVFYVSGDDEFIIKTVQHKEAEFLQKLLPGYYMNLNQNPRTLLPKFYGLYCVQAGGKNIRIVVMNNLLPRSVRMHLKYDLKGSTYKRRASAKEREKKSPTYKDLDFLQDLPDGLFLDPDMHNALCKTIQRDCLVLQSFKIMDYSLLVGVHNMDCAQKETAVDGHTQSDTRRPAAQKALYSTAMESIQGEARRGGAIETDDQMGGIPARNAKGERLLLYIGVIDVLQSYRFMKKLEHSWKALVHDGDTVSVHRPGFYADRFQKFMCSIVFKKIPLKTSPSKKSRTMPGVSRRATQAAVPTQLQLVEEHKQYLATEVESEPGSQFGRPDLLPRTPPVDEAASDSLATTLSTSSLGSGGLNSPAHRSVGVEVHKVETTEIELNAVRSEVLDESNQEDEAGGEEEEEEALDISQIETEIRF
Donor tissue: tailbud