ORFeome > pitx1 – XORFeome 2.0

pitx1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis paired-like homeodomain 1, mRNA (cDNA clone MGC:79589 IMAGE:6979090), complete cds
Gene Symbol: pitx1
Gene ID: 493226
ORF gb_acc: MG133635
ORF ID: 11181

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC079936

Library Location

Plate ID: GDExt11011
Well Location: B12

EST Sequences

Clone: MGC:79589 IMAGE:6979090
Trimmed Sequence: ATGGATTCCTTTAAAGGAGCTATGAATTTGGAAAGATTGCCTGAGAGTTTAAGACCCCAGCCTTCCCACGACATGGCCACTAGTTTCCATTTGCAGCGATCATCTGAAGCCAGGGATCCCATGGACAATTCAGCCAGTGAGTCTTCTGATACTGAAATCGCAGAGAAAGAACGAAGTGGGGAGCCAAAGGGAGAGGACGGCAATGGGGATGATCCCACAAAGAAAAAGAAGCAGAGGAGACAAAGGACTCACTTTACCAGCCAGCAGCTGCAGGAGCTGGAGGCCACTTTCCAGAGGAACCGCTACCCAGACATGAGCATGAGAGAGGAGATCGCTGTATGGACCAATCTGACTGAGGCCAGGGTCAGGGTCTGGTTCAAGAACCGCAGAGCCAAGTGGAGGAAGAGGGAGCGGAACCAGCAGATGGACCTGTGCAAGAATGGCTACGTGCCCCAGTTCAGCGGCCTGATGCAGCCCTACGATGAGATGTACGCTGGCTACCCGTACAACAACTGGGCCACCAAAAGCCTCACCCCTGCCCCCCTGTCCACCAAGAGCTTCACCTTCTTCAACTCCATGAGTCCGCTGTCCTCCCAGTCCATGTTCTCTGGCCCCAGCTCCATCTCTTCCATGAGCATGCCCTCCAGCATGGGCCACTCGGCGGTGCCCGGCATGCCCAACTCTAGTCTTAACAACATCAACAACCTTAATAACATCAGCAGCTCCTCCCTCAACTCCGCCATGTCTTCTACTGCTTGTCCCTATGGCCCCCCCGGCTCCCCATACACGGTATACAGGGACACTTGTAACTCGAGTTTGGCCAGCCTGAGACTGAAATCCAAGCAGCACTCCACCTTTGGCTACAGTAGCCTGCAGAGCCCGGCCTCCAGCCTCAATGCCTGCCAGTATAACAGTTGA
Full Trace Sequence: ggctagcaagtccagcactctcatacatgcatgcctgggaacctgcagccaccgatctgctgaaaggaagacgaaataaaaaaggggaaaacttctgtaaaggcgtttccatgggccgccaccctgagaagggcagaaagtggatttgatttggttggtgtaggattttgtggaatacgcgtttcatgagcagagtgatttaccatggattcctttaaaggagctatgaatttggaaagattgcctgagagtttaagaccccagccttcccacgacatggccactagtttccatttgcagcgatcatctgaagccagggatcccatggacaattcagccagtgagtcttctgatactgaaatcgcagagaaagaacgaagtggggagccaaagggagaggacggcaatggggatgatcccacaaagaaaaagaagcagaggagacaaaggactcactttaccagccagcagctgcaggagctggaggccactttccagaggaaccgctacccagacatgagcatgagagaggagatcgctgtatggaccaatctgactgaggccagggtcagggtctggttcaagaaccgcagagccaagtggaggaagagggagcggaaccagcagatggacctgtgcaagaatggctacgtgccccagttcagcggcctgatgcagccctacgatgagatgtacgctggctacccgtacaacaactgggccaccaaaagcctcacccctgcccccctgtccaccaagagcttcaccttcttcaactccatgagtccgctgtcctcccagtccatgttctctggccccagctccatctcttccatgagcatgccctccagcatgggccactcggcggtgcccggcatgcccaactctagtcttaacaacatcaacaaccttaataacatcagcagctcctccctcaactccgccatgtcttctactgcttgtccctatggcccccccggctccccatacacggtatacagggacacttgtaactcgagtttggccagcctgagactgaaatccaagcagcactccacctttggctacagtagcctgcagagcccggcctccagcctcaatgcctgccagtataacagttgatagactccccagctgtgtgccaaccctgtggactctcacaatggaccagacaatactttttgtgcaagacaccgaatctaagaacacatggatgagttgcaatttttctctggattatgcgggttgtatgtgtttacttgaacttgcacagaagttctctgtagccactctcccggggagagactggagacaacacacatttatatggaacacgttggtggcagtagtggcccctctggtggcggtacccacggagattgcgcatcgcctaccactgacaccacaggaatctgcagccttggaatctatagggagaggaaaaacaatgaataaaggggtttgaacagaaaaaaaacacacaagggttaaccacttaaaaaggttatatgtatatataaatatataagccgctacattgtgtctgatgcttgtgcggcggttcaatttggtttcacaacaaatgcatgattctcagtgtttgttcagctacaaggaagatccgattgtttccaaatacaacgttcttcgttctagaatcccctacagatccactctggaaccattcgatccatctccacggctcttctacggttatttcataccccccccccccccctccaaatgatcctggcaattgtatgtatgctatgcttatagatcaatcgatcgtcattatttatctgcaatttatagctccctatatgtatcctaaatatgctatgtacaaataataaatcattcaaaccttcttgtgactcctgacagtgcatcaataaaccacctggaacccgtaagaataactcgagttgttttccaatttctagaaaacgtttgaatgggaaaacatattttcaaagaaataatctaaagtttagattatttaaggatggtttaaaaaaaaaaacaaactaaataaattattttttaatattaaaacgcatacaaaacgcatatgaagtttaattgcaggcgtatttgtgacttgtcagtacgaagggatctatattaagtgcacaaacttttacccccatctttcccctctgtgtattgtacacctgtggtaaaggttatgtggatgtgtggatgttaaataatgctcttgtggataagaatgcagtgtattgttttttttataagttatgttttttgttttgtgatttttttttcaaaaattaagagcatgggaataaaacgaatctaagaaataaaaaaaaaaaaaaaaaaa
Translation: MDSFKGAMNLERLPESLRPQPSHDMATSFHLQRSSEARDPMDNSASESSDTEIAEKERSGEPKGEDGNGDDPTKKKKQRRQRTHFTSQQLQELEATFQRNRYPDMSMREEIAVWTNLTEARVRVWFKNRRAKWRKRERNQQMDLCKNGYVPQFSGLMQPYDEMYAGYPYNNWATKSLTPAPLSTKSFTFFNSMSPLSSQSMFSGPSSISSMSMPSSMGHSAVPGMPNSSLNNINNLNNISSSSLNSAMSSTACPYGPPGSPYTVYRDTCNSSLASLRLKSKQHSTFGYSSLQSPASSLNACQYNS
Donor tissue: tailbud