ORFeome > pld3 – XORFeome 2.0

pld3 – XORFeome 2.0

General Information

Species: Xenopus tropicalis phospholipase D family, member 3, mRNA (cDNA clone MGC:88878 IMAGE:6998221), complete cds
Gene Symbol: pld3
Gene ID: 496432
ORF gb_acc: MG134066
ORF ID: 11685

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC082717

Library Location

Plate ID: GDExt11016
Well Location: D09

EST Sequences

Clone: MGC:88878 IMAGE:6998221
Trimmed Sequence: ATGAATCCCAAAGTTGAGTACAAACAAATACAGTCTCATGACGAAGCAGAAAATCAAGTTCTCCAGCATGAGTGTCACCAGGCGAAAGCTCGCAAGTACTACCGATGTGCAGTTGTCATCGCCATTATTATCACCCTCCTGTTCTGTGTCCTGGCTTCACAGCTTCTTCTCTTTCCACTTTTTTCCATAACCTCTCAAACAACAACTGAGATAGTGCTAAACAAGGACATCCAATGTGATGATCAATGCAGGTTTGTTCTTGTAGAGAGCATCCCTGAAGGATTGGTGTATGATGCCAATGCCACGATAAATCCTTCAATTTTCCAGTCATGGCTGAACATTCTTACTAGTGCTAAGAGTAGTGTTGACATTGCATCATTTTACTGGACTCTGACCAATGAGGATACACAAACTCAGGAGCCCTCAGCTCACCAGGGAGAATTGATCCTACAAGAGCTTCTGAATCTAAAGCAGCGAGGAGTGTCTGTAAGAGTTGCTGTTAATCCTCCAGATTCCCCACTAAGAGCCAAAGACATTTCTGCTCTAAAAGACAGTGGAGCAGATGTACGTGTGGTAGACTTGCCAAAGCTAACAGATGGTGTTCTGCATACTAAATTTTGGGTTGTTGACAGTGAACATTTTTACATTGGTAGTGCTAATATGGATTGGAGATCTTTAACACAGGTGAAAGAACTTGGTGCAACCATATATAATTGCAGCTGCCTAGCCGAAGATTTGAAGAAAATCTTTGAAGCGTATTGGATCCTTGGGTTACCCAATGCTACTTTGCCCTCCCCATGGCCGGTTAATTATTCAACACCATACAACAAGGATACACCAATGCAAGTGATGCTAAACAGCACAGCATCTCAGGTTTATATTTCGAGCTCACCACCCCCACTCTCAGCAACTGGGAGGACCGATGATCTCCAGTCCATTATTAACATTATAGATGATGCCAAAAAATTTGTATATATTTCTGTCATGGACTACTCTCCCACCGAGGAATTCTCCCATCCAAGGAGATACTGGCCTTATATTGACAACCATTTGAGGAAAGCCGTCTATGAAAGAAATGTAAATGTCCGCTTGCTGATCAGCTGCTGGCAAAATTCCAGACCTTCCATGTTCACATTCCTTAGATCCCTGGCTGCATTGCACAGTAACAAAAGCCATTACAACATTGAAGTGAAAATATTTGTGGTCCCTGCAACTGAGGTACAAAAGAAGATTCCATATGCCAGAGTGAATCACAATAAGTACATGGTGACAGACAGAGTGGCATATATTGGTACATCTAACTGGTCTGGGGACTATTTCATACACACTGCTGGCTCAGCATTGATAGTGAACCAGACACAGTCTGTTGGCACTTCAGACACTATCCAGATGCAATTACAAGCAGTGTTTGAAAGAGACTGGAATTCAAATTACAGCCGGACTTTTAACACTTTAAGTTCATGGAAGGAAAAATGTATCTTTTAG
Full Trace Sequence: agaagctgggccatgattcaaaggatatctggagatgcaatgaatcccaaagttgagtacaaacaaatacagtctcatgacgaagcagaaaatcaagttctccagcatgagtgtcaccaggcgaaagctcgcaagtactaccgatgtgcagttgtcatcgccattattatcaccctcctgttctgtgtcctggcttcacagcttcttctctttccacttttttccataacctctcaaacaacaactgagatagtgctaaacaaggacatccaatgtgatgatcaatgcaggtttgttcttgtagagagcatccctgaaggattggtgtatgatgccaatgccacgataaatccttcaattttccagtcatggctgaacattcttactagtgctaagagtagtgttgacattgcatcattttactggactctgaccaatgaggatacacaaactcaggagccctcagctcaccagggagaattgatcctacaagagcttctgaatctaaagcagcgaggagtgtctgtaagagttgctgttaatcctccagattccccactaagagccaaagacatttctgctctaaaagacagtggagcagatgtacgtgtggtagacttgccaaagctaacagatggtgttctgcatactaaattttgggttgttgacagtgaacatttttacattggtagtgctaatatggattggagatctttaacacaggtgaaagaacttggtgcaaccatatataattgcagctgcctagccgaagatttgaagaaaatctttgaagcgtattggatccttgggttacccaatgctactttgccctccccatggccggttaattattcaacaccatacaacaaggatacaccaatgcaagtgatgctaaacagcacagcatctcaggtttatatttcgagctcaccacccccactctcagcaactgggaggaccgatgatctccagtccattattaacattatagatgatgccaaaaaatttgtatatatttctgtcatggactactctcccaccgaggaattctcccatccaaggagatactggccttatattgacaaccatttgaggaaagccgtctatgaaagaaatgtaaatgtccgcttgctgatcagctgctggcaaaattccagaccttccatgttcacattccttagatccctggctgcattgcacagtaacaaaagccattacaacattgaagtgaaaatatttgtggtccctgcaactgaggtacaaaagaagattccatatgccagagtgaatcacaataagtacatggtgacagacagagtggcatatattggtacatctaactggtctggggactatttcatacacactgctggctcagcattgatagtgaaccagacacagtctgttggcacttcagacactatccagatgcaattacaagcagtgtttgaaagagactggaattcaaattacagccggacttttaacactttaagttcatggaaggaaaaatgtatcttttagatctttttgatctagtgtgaacagtgtatatagcaagaaggggtaacctatgcaattttctggggggaaaggatgcgtggtaaaggttttgaaaatactacttgaggggattacagggttatagtattatattcctttccaatactgaaaagtggtgaaagaacttttcagtggtgcaaaatgtttatcaaagcagaaggctagtaatagcttgttacagccccaaaaatgtgttcagagaatctttagaatatggctcatgtatgtacaaactgttcagacttatactgcactgcactttacatttatatatggactcaaggcagcttttctaagggcaggtcccttttatttgactactgggaaaagatcaatgctatgttctttgccctatggttctatttgcttcaggaatcactaagccagtcagtgctcaacaaactggagttaaagctaaaacttgaaaactgagtagctgcacaatgtaaaactcctaactttaacagaaattattatgcattttaacagaaattattatgcatttctaaacaaatttgtctcatcttttcttagctcaccctttaaactttgtgcttctttctacatcacatgtatggacgatgctgtgactgccagatcagttccattaaatttacctgtatgtgatcaatccttacacttgattctaagcaatgccatgcttcttctgctgtgagttttgttttataacctgtaactggttgggaaactgtatataaactttaataaagcttaataaaacaccaaaacacaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MNPKVEYKQIQSHDEAENQVLQHECHQAKARKYYRCAVVIAIIITLLFCVLASQLLLFPLFSITSQTTTEIVLNKDIQCDDQCRFVLVESIPEGLVYDANATINPSIFQSWLNILTSAKSSVDIASFYWTLTNEDTQTQEPSAHQGELILQELLNLKQRGVSVRVAVNPPDSPLRAKDISALKDSGADVRVVDLPKLTDGVLHTKFWVVDSEHFYIGSANMDWRSLTQVKELGATIYNCSCLAEDLKKIFEAYWILGLPNATLPSPWPVNYSTPYNKDTPMQVMLNSTASQVYISSSPPPLSATGRTDDLQSIINIIDDAKKFVYISVMDYSPTEEFSHPRRYWPYIDNHLRKAVYERNVNVRLLISCWQNSRPSMFTFLRSLAALHSNKSHYNIEVKIFVVPATEVQKKIPYARVNHNKYMVTDRVAYIGTSNWSGDYFIHTAGSALIVNQTQSVGTSDTIQMQLQAVFERDWNSNYSRTFNTLSSWKEKCIF
Donor tissue: