ORFeome > plxna3 – XORFeome 2.0

plxna3 – XORFeome 2.0

General Information

Species: Xenopus tropicalis plexin A3, mRNA (cDNA clone MGC:89495 IMAGE:6992240), complete cds
Gene Symbol: plxna3
Gene ID: 448633
ORF gb_acc: MG134001
ORF ID: 11601

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC076975

Library Location

Plate ID: GDExt11015
Well Location: A11

EST Sequences

Clone: MGC:89495 IMAGE:6992240
Trimmed Sequence: ATGGGACCTTTGCAGAGTCTCCTCCTCCTTTTCCTTACCTGTTCCGTAGGGGAGGGGGCCTCTGTGTTCCCCACCTTCGCTGTGTCGGACACCTCCCTCACTCACCTTGCGGTGCACAAACACACCGGCGATGTCTATCTTGGAGCCGTCAACCGAATCTTCAAACTCTCCGAGAATCTGACGGAGTTACGTTCCCATCTCACCGGCCCCATTGCAGATAATTCAAGCTGTTACCCTCCCCCAAGCGTGCGCGTCTGCACCCACAAACTGTCCCCCACCGATAATGTCAACAGGCTGCTGCTGATAGACTACACGGGCAAGCGGGTGGTGGCCTGTGGCAGCGTGTGGCAGGGCATCTGTCAGTTCCTGCGGCTCGACGACCTCTTCAAGTTGGGCGAGCCCCATCACCGCAAGGAGCACTATCTGTCGGGAGCTCGCGAGCCAGACTCTATGGCGGGGGTCATTGTGGACCAGGACGTGGAGCAGAGCAAGCTGTTCATTGGTACGTCCATAGATGGCAAGTCGGAGTATTTCCCCACCCTATCCAGTCGCAGGTTAGTGCAGGACGAGGAGAGCGCCGAGATGTTCCGCTTGGTGTATCAGGATGAGTTTGTCTCCTCCCAAATCAAGGTGCCCTCCGACACCCTGTCCCTGCACCCGTCCTTTGACATATACTACGTGTATGGATTTGTTAGCAAGATCTTTGTCTATTTCCTCACACTCCAACTGGACACACAACAGACGTTGCTGGATGCCACGGGGGAGAAATTCTTTACGTCAAAAATTGTGCGAATGTGCTCCGGCGACCTGGAGTTTTACTCTTATGTGGAGTTTCCCATTGGCTGCACCAAAGATGGAGTGGAATACCGGCTCATACAAAGCGCCTATCTGAGTCGGCCGGGCCGGAAATTGGCACAGGCGCTGGGCATCCCCGAGGATGAAGAAGTCTTGTTTACGGTTTTCTCCCAGGGACAGAAGAACCGCTCCAATCCACCTCGGGAGTCCGTCCTCTGCCTCTTCACCCTTAGCCAAATCAACCTTCATATCAAGATGCGCATCCAGTCTTGCTACCATGGAGAAGGAAAACTGTCCCTGCCGTGGCTGCTCAACAAGGAGTTATTCTGTATCAGCACGGTGAGTGGGTGCATTGGGGCCTTCACTGAAGCACAGGGTCCCTCTCCGTGGCGCTTCCACCTGAGCAGCCAGGAACATTACCCTTCCCACCATCTTTCATTTATAGAGCTCTGCCATACAGTGCTGTGCGGCTGTGCCAAGGGCAGGAGGGAATGA
Full Trace Sequence: cgaagcgggcggagggtcttcgtcgattttcgtgaaaaaggaacgtaaccggggagagctctggattctatcaacgggaagagcagcgtcacttcggattaaccagctggatgccgggagagaaggaaccacgtgtgagatctgctggcaccagaagctgagctgtctctgcaaagcatgatgggacctttgcagagtctcctcctccttttccttacctgttccgtaggggagggggcctctgtgttccccaccttcgctgtgtcggacacctccctcactcaccttgcggtgcacaaacacaccggcgatgtctatcttggagccgtcaaccgaatcttcaaactctccgagaatctgacggagttacgttcccatctcaccggccccattgcagataattcaagctgttaccctcccccaagcgtgcgcgtctgcacccacaaactgtcccccaccgataatgtcaacaggctgctgctgatagactacacgggcaagcgggtggtggcctgtggcagcgtgtggcagggcatctgtcagttcctgcggctcgacgacctcttcaagttgggcgagccccatcaccgcaaggagcactatctgtcgggagctcgcgagccagactctatggcgggggtcattgtggaccaggacgtggagcagagcaagctgttcattggtacgtccatagatggcaagtcggagtatttccccaccctatccagtcgcaggttagtgcaggacgaggagagcgccgagatgttccgcttggtgtatcaggatgagtttgtctcctcccaaatcaaggtgccctccgacaccctgtccctgcacccgtcctttgacatatactacgtgtatggatttgttagcaagatctttgtctatttcctcacactccaactggacacacaacagacgttgctggatgccacgggggagaaattctttacgtcaaaaattgtgcgaatgtgctccggcgacctggagttttactcttatgtggagtttcccattggctgcaccaaagatggagtggaataccggctcatacaaagcgcctatctgagtcggccgggccggaaattggcacaggcgctgggcatccccgaggatgaagaagtcttgtttacggttttctcccagggacagaagaaccgctccaatccacctcgggagtccgtcctctgcctcttcacccttagccaaatcaaccttcatatcaagatgcgcatccagtcttgctaccatggagaaggaaaactgtccctgccgtggctgctcaacaaggagttattctgtatcagcacggtgagtgggtgcattggggccttcactgaagcacagggtccctctccgtggcgcttccacctgagcagccaggaacattacccttcccaccatctttcatttatagagctctgccatacagtgctgtgcggctgtgccaagggcaggagggaatgaggctcagcttgttggaatgagtgtaagggcagggggttggttatatggggagcaaatgttgcactaggtcgctggtacaaaggcaagttcatacacgcaaggaaggatagggtgctactgtaccatatggggtcccagtaggtggtccctctgtgttatttggggtgagaggtaccctagtgtgtgggggcagcagctttgtcatcactaacccccagcccggggcacagcctgaagccctctgcagcctctttcctttctgctcctattcatacttcagtctctttcaagccctgcctggttgctatggttaccaagaccctagcaaccagatagctgctaaaattccaaactggagagctgctcagcgaaaagctaaataactgaaaaaccacaacaaataaaaaatgaagaccaaaaaaaaaaaaaaaaa
Translation: MGPLQSLLLLFLTCSVGEGASVFPTFAVSDTSLTHLAVHKHTGDVYLGAVNRIFKLSENLTELRSHLTGPIADNSSCYPPPSVRVCTHKLSPTDNVNRLLLIDYTGKRVVACGSVWQGICQFLRLDDLFKLGEPHHRKEHYLSGAREPDSMAGVIVDQDVEQSKLFIGTSIDGKSEYFPTLSSRRLVQDEESAEMFRLVYQDEFVSSQIKVPSDTLSLHPSFDIYYVYGFVSKIFVYFLTLQLDTQQTLLDATGEKFFTSKIVRMCSGDLEFYSYVEFPIGCTKDGVEYRLIQSAYLSRPGRKLAQALGIPEDEEVLFTVFSQGQKNRSNPPRESVLCLFTLSQINLHIKMRIQSCYHGEGKLSLPWLLNKELFCISTVSGCIGAFTEAQGPSPWRFHLSSQEHYPSHHLSFIELCHTVLCGCAKGRRE
Donor tissue: neurula