ORFeome > ppp2r5c – XORFeome 2.0

ppp2r5c – XORFeome 2.0

General Information

Species: Xenopus tropicalis protein phosphatase 2, regulatory subunit B, gamma isoform, mRNA (cDNA clone MGC:76127 IMAGE:5309201), complete cds
Gene Symbol: ppp2r5c
Gene ID: 394858
ORF gb_acc:
ORF ID: 10016

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC063910

Library Location

Plate ID: GDExt11001
Well Location: F07

EST Sequences

Clone: MGC:76127 IMAGE:5309201
Trimmed Sequence: ATGCCTAATAAAAACAAGAAAGATAAAGAACCTCCAAAAGCTGGTAAAAGTGGCAAAACTGGAAAAGAAGGCCAAGATAATCCTGAGCATGAAGTATCCAACAAAAAGTCCAACAATACTCCCCCTCCAGCTCAGGTATCAAAGATAAAGGTACCCACTCCACAGGCTGTTGTTAAGAAAGAGAAGCGGCAGAGTTCCTCAAGATTTAATGTGAGCAATAATAGAGAACTGCAGAAACTACCAGCTCTTAAAGATGTACCCCCAGCAGAACAAGAAAAGCTGTTTGTTCAGAAATTGCGCCAGTGCTGCGTTCTTTTTGACTTTGTTTCGGATCCTCTAAGTGACCTGAAATGGAAGGAAGTAAAACGAGCTGCACTAAGTGAGATGGTGGAATACATCACACACAATCGCAATGTGATCACAGAACCTATTTATCCTGAGGTAGTTCACATGTTTGCTGTGAATATGTTTCGAACATTACCACCATCCTCCAATCCAACAGGGGCAGAATTTGACCCAGAAGAAGATGAACCAACGTTAGAAGCAGCATGGCCTCATTTACAGCTTGTGTATGAATTTTTCCTCCGGTTTTTGGAGTCTCCAGATTTCCAACCCAATGTAGCTAAGAAATACATTGATCAGAAATTTGTGCTACAGCTGCTGGAGCTGTTTGACAGTGAAGATCCAAGAGAGAGAGATTTTCTGAAAACAACACTTCATAGAATCTATGGGAAATTTTTAGGCCTCAGAGCTTATATAAGGAAACAGATCAATAATATATTTTATAGGTTTATTTATGAAACAGAACACCATAATGGCATAGCAGAGCTATTGGAAATCCTTGGAAGTATAATCAATGGATTTGCATTACCGTTGAAAGAAGAGCACAAAATTTTTTTACTAAAGGTGTTATTACCTTTACACAAAGTGAAGTCACTCAGTGTCTACCACCCACAGCTGGCATATTGCGTAGTACAGTTTTTAGAAAAAGACAGCACTCTGACTGAACCAGTGGTAATGGCATTACTTAAATATTGGCCGAAAACCCACAGTCCAAAGGAAGTCATGTTTTTAAATGAGCTGGAAGAAATTTTAGATGTGATAGAGCCTTCAGAGTTTGTAAAAGTCATGGAGCCTCTTTTCCGGCAGCTGGCCAAGTGTGTTTCAAGTCCGCACTTTCAGGTTGCAGAAAGAGCATTGTATTATTGGAATAATGAGTATATCATGAGTTTAATCAGTGATAATGCAGCTAAGATTTTGCCCATTATGTTCCCATCCTTGTATCGGAATTCAAAGACACATTGGAACAAGACAATTCATGGTTTGATATACAATGCCCTGAAACTTTTTATGGAGATGAACCAAAAATTATTTGATGACTGCACTCAACAGTTCAAAGCAGAAAAGCAGAAGGAAAAACTAAAACTGAAAGAACGAGAAGAAGCATGGATTAAAATTGAAAATCTAGCCAAATCTAATCCCCAGTACCCTATGTATACTGACACCTCTGCTCTGAACAGTCCTGTTGCAATGGAAACAGATGGGCCCTTACTTGAAGACGTACAGATGCTTAAAAAGACAGTAAAAGAAGAAGCTTCTCAGGCTCAAAAAGATCTAAAGAAGGAACGGCCTCTTGTGCGACGTAAATCAGAATTGCCTCAGGACATCTATACCATGAAAGCCTTGGAATCCCACTGCAGAGCTGATGAATTAATATCACATGATGGGCATTAG
Full Trace Sequence: caccggagtaccacagccaccggaaaggaggaggcacacgaagagccgctgccatgcctaataaaaacaagaaagataaagaacctccaaaagctggtaaaagtggcaaaactggaaaagaaggccaagataatcctgagcatgaagtatccaacaaaaagtccaacaatactccccctccagctcaggtatcaaagataaaggtacccactccacaggctgttgttaagaaagagaagcggcagagttcctcaagatttaatgtgagcaataatagagaactgcagaaactaccagctcttaaagatgtacccccagcagaacaagaaaagctgtttgttcagaaattgcgccagtgctgcgttctttttgactttgtttcggatcctctaagtgacctgaaatggaaggaagtaaaacgagctgcactaagtgagatggtggaatacatcacacacaatcgcaatgtgatcacagaacctatttatcctgaggtagttcacatgtttgctgtgaatatgtttcgaacattaccaccatcctccaatccaacaggggcagaatttgacccagaagaagatgaaccaacgttagaagcagcatggcctcatttacagcttgtgtatgaatttttcctccggtttttggagtctccagatttccaacccaatgtagctaagaaatacattgatcagaaatttgtgctacagctgctggagctgtttgacagtgaagatccaagagagagagattttctgaaaacaacacttcatagaatctatgggaaatttttaggcctcagagcttatataaggaaacagatcaataatatattttataggtttatttatgaaacagaacaccataatggcatagcagagctattggaaatccttggaagtataatcaatggatttgcattaccgttgaaagaagagcacaaaatttttttactaaaggtgttattacctttacacaaagtgaagtcactcagtgtctaccacccacagctggcatattgcgtagtacagtttttagaaaaagacagcactctgactgaaccagtggtaatggcattacttaaatattggccgaaaacccacagtccaaaggaagtcatgtttttaaatgagctggaagaaattttagatgtgatagagccttcagagtttgtaaaagtcatggagcctcttttccggcagctggccaagtgtgtttcaagtccgcactttcaggttgcagaaagagcattgtattattggaataatgagtatatcatgagtttaatcagtgataatgcagctaagattttgcccattatgttcccatccttgtatcggaattcaaagacacattggaacaagacaattcatggtttgatatacaatgccctgaaactttttatggagatgaaccaaaaattatttgatgactgcactcaacagttcaaagcagaaaagcagaaggaaaaactaaaactgaaagaacgagaagaagcatggattaaaattgaaaatctagccaaatctaatccccagtaccctatgtatactgacacctctgctctgaacagtcctgttgcaatggaaacagatgggcccttacttgaagacgtacagatgcttaaaaagacagtaaaagaagaagcttctcaggctcaaaaagatctaaagaaggaacggcctcttgtgcgacgtaaatcagaattgcctcaggacatctataccatgaaagccttggaatcccactgcagagctgatgaattaatatcacatgatgggcattagactatgacaattatatattactttgtggattcttcttttttccggaagcagttacacagtagaaaactattacttttttgtgccataccaatctgttaaacacagtgaaagctttcttcgacccagttctgtaggcaataactaaacacagtgtacagctcaagattagatgttcaaacaatggtgatatacctgattctgtatgcagaacattgggttgaattatattaagtagccacacagctggctggaaacaggagtaccaattggagatgtacgtcaagaagtctaccattgctcaaagtaaagcactgataggatttacagcaaaatgacagccatgcaaatgtcaaattggtgcttaaaagagatctgcttattagtttaagtactaacctttctttggtctctcttaaatgagtgtctggtattcttgcagttaggggaacaaaataggctttacttgcatgtgctatatagagttcaatgggtaattttctgacaatcccaaataggtttttctcagttatgtatattgtttgcattgaatgagctcatgaattgttgaagtactttctgtgtattgaaagccatatttttgtcactcatagcaaagtattaccgttccattatactagaagtgcactaagatcgtgtattgccctggggtaagtcaaataacttaaacttcaacaacaaacttaagtgttgaaaattttgtttttcttgaaataaaatcctgtttcactgctgatgtttctgctgaccatttgggggtattggcctggttttggcctttctcaaacacattagtactacatagcaagtaaacacaatttcaaggcaaatacatacatatcattaaaaaaaaataagaagtgcatgtttggtgctgacagtatgcaaaaggtgtacccttttattgctaagtgtccagtgggccattgaaattaaaggcatctccagcaacagaagggttaagtttaagaactggcatgcatccacattctctgtttctattttagaagcacacgtacaggcagattttgcaggtaatatgtaaatatttccatgtcattttccatatgcagtgctgctatattttcaccaaggttatatgcatgttctgcccttttgttataggtaacaaaaacagcagagtaaatgtgagccctgtcatccttctctctatttctcagggtggccagtattaatgttgctatggaaggtagtttttgaaggggggcggtgggggtcccttttcaaatgagatacaatacaagtatatttgtggtcaaaattctttaaaaaatatttttcctatacaaagtaaaactcttatcattttgctcaaacatgtttaaaataaattagattagttaatctaatctaacttttgctacgtgcacaaaatatctaggctttttttcctgaactgtcatttagtgttcattaagcataggaaggctctgatataaaaacccttaagacgttccaagatccccatgttgtaagaattcctgtttaaacttgaaaactaacgctttaacaataatacaaagtggaggtgataccatatctttaagggacactgggtgcttgtatattgtgtatatatatctatatatttggtataccattgtttgaacttccatcttttgctgtattttttttttctcatgtttattttttctgtttaattttttttttctcatatattggcagcaagtttctagaaagacatatttctttgtttttacctgacatttaacttgtttatcagtgtttggttgattgtctaatgctcagcatataagaacatttactgtccagacttttactgttgacctttatttaagataaacattcaccaatcgaatcttcacgctcctttttgcatatccctgtaatgatctggggttgcaatatgtggatcatttttaaggaccgattctgcactttaaaaaaaaaaaacattggattggattaaactatttcaaatgtatcttatcaatagaaacttaagctaatttgtggagaggttgtaatgcgtcctcttattgagatatatgagataaagcagcaccactgtgcagccttttacctgtagtgggtcatacaggagcttttacctgtagtgggtcatacaggagccaaattatataaaaacatttttcaacattttacagagcccttgaacagcatggggggcataaaaaatccctttgagggacatatccggccagtggcctccagctggacagccctgtaataaaatttaatatagctttgacgtagcttctgctcctgcaatatcttagtgaaacctcaaattaaaaataattcctactaatgtcttttggtgattgcttatcttaaagtgaaataaactccccatttgttgacttcacatgcttttccaagaattttacatgtacatgaggaatgttaacagtaatatgatgagtgtcttttagtgtggctttagtatggctttattttaatattgtacatacattgtactttgttttatggtaataacgtaataaaactttagacttcatattttgtacaaaatggccctgtctacccgttacaaatgctagaatggaaatagctgggagaaagcaccttagcattgtcatttcctcttaccaacccactcctatctttcacagacacacatgcctacatatatctaacctggactaaagttagtttaccaggttatccttaaatatgttagtttgattgcaattttgtaacccttttttcttttgctatttatcaaagcacttgccaattaatgtgctacttctttcaagctaacatggtgtataatatggactcaataaagaacatgtgacttttttttttgttcagtaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MPNKNKKDKEPPKAGKSGKTGKEGQDNPEHEVSNKKSNNTPPPAQVSKIKVPTPQAVVKKEKRQSSSRFNVSNNRELQKLPALKDVPPAEQEKLFVQKLRQCCVLFDFVSDPLSDLKWKEVKRAALSEMVEYITHNRNVITEPIYPEVVHMFAVNMFRTLPPSSNPTGAEFDPEEDEPTLEAAWPHLQLVYEFFLRFLESPDFQPNVAKKYIDQKFVLQLLELFDSEDPRERDFLKTTLHRIYGKFLGLRAYIRKQINNIFYRFIYETEHHNGIAELLEILGSIINGFALPLKEEHKIFLLKVLLPLHKVKSLSVYHPQLAYCVVQFLEKDSTLTEPVVMALLKYWPKTHSPKEVMFLNELEEILDVIEPSEFVKVMEPLFRQLAKCVSSPHFQVAERALYYWNNEYIMSLISDNAAKILPIMFPSLYRNSKTHWNKTIHGLIYNALKLFMEMNQKLFDDCTQQFKAEKQKEKLKLKEREEAWIKIENLAKSNPQYPMYTDTSALNSPVAMETDGPLLEDVQMLKKTVKEEASQAQKDLKKERPLVRRKSELPQDIYTMKALESHCRADELISHDGH
Donor tissue: gastrula