ORFeome > prpf4 – XORFeome 2.0

prpf4 – XORFeome 2.0

General Information

Species: Xenopus tropicalis PRP4 pre-mRNA processing factor 4 homolog, mRNA (cDNA clone MGC:75813 IMAGE:5382356), complete cds
Gene Symbol: prpf4
Gene ID: 394655
ORF gb_acc: MG132915
ORF ID: 10281

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC061324

Library Location

Plate ID: GDExt11004
Well Location: E01

EST Sequences

Clone: MGC:75813 IMAGE:5382356
Trimmed Sequence: ATGTCGGATGATGAAGGGCCCCCCGTGGTGAAAAGGTCGCGCATATTCTACGGCAGCCTGGCCGACAAGGAGAGGGAGCGTCTGGCCAAGGGGGAGGCCCCGATGGGCAGGTCGGCGGTACGGGCGGGCATCGATGCCGGGAACATTAACATTAGCGGAGGGGAGTCGTTTGACCTGGAGGAGCACATCAGCGAGCGGCAGGCCGAGGTACTGGCGGAGTTTGAGCGCAGGAAGCGCGCGCGGCAGATCAACGTCTCCACCGATGACTCCGAGGTGAAGGCGTGTCTCCGGGCCCTCGGGGAGCCCATTACGCTCTTTGGGGAGGGGCCAGCGGAAAGGAGGGAGCGCCTGAGGAACGTGCTGTCCGTGGTGGGCACCGACGCCTTGAAGAAAACCAAGAAAGACGAAGAGAAGAGCAAGAAGTCGAGCGACGAGTATCAGCAAACCTGGTATCACGAGGGCCCCAATACGCTGAAAATGGCTCGCCTGTGGCTGGCGCACTACTCCCTCCCTCGGGCTCTGACGCGGCTGCAGGCTGCCAGGGAGCAGCGGGGGATCCCAGAATCCACCAGGACTTCCCAGAAACAGGAGCTGAATAAGTCTCTGCAGTCCCTGAATAATTTCTGCAGCCAAATCGGAGACGACCGGCCGCTGTCCTTCTGCCACTTCAGCCCCAACTCCAAGATGTTGGCCACAGGCTGCTGGAGTGGGCTGTGCAAGTTATGGTCTGTGCCAGACTGCAACCTGATCCGAACCCTAAGAGGACACAACACAAACGTGGGCGCCATAGTGTTCCACCCCAAGGCCACAATCTCATTGGAGGAGAAGGATGTGAATTTGGCTTCCTGCGCGGCCGACGGCTCCGTCAAACTCTGGAACCTGGAGAGTGACGAGCCGGTGGCTGATATTGAGGGTCACTCAGTGCGGGTGGCGCGGGTAACGTGGCATCCGTCCGGCAGGTTCCTGGGCACCACCTGCCATGATCGTTCCTGGAGACTGTGGGACCTGGAAGCCCAGGAGGAAATCCTGCACCAGGAGGGGCACAGCAAGGGGGTGTACGACATAGACTTCCATACGGACGGGTCATTAGCTGCCACCGGGGGTCTCGATGCCTTCGGCAGAGTCTGGGATCTACGTACCGGCCGCTGCATTATGTTCCTGGAGGGGCACCTTAAGGAGATCTACGCCGTCAACTTCTCCCCCAATGGGTACCACGTTGCTACCGGCAGCGGTGACAACTCGTGCAAAGTGTGGGACCTGCGGCAGCGCCGGTGCATCTACACGATCCCGGCCCACCAGAACCTCACCAGCTCCGTCAAGTTTCAGCCCACCAATGGGAATTACCTGCTGACCGGCGCCTATGACAACACGGCCAAAGTTTGGACACACCCCCTGTGGGCGCCATTAAAGACTCTCGCTGGGCATGAGGGGAAGGTCATGGGAGTTGACATTTCACCGGACGGAGAATTAATCGCCACCTGTTCCTACGACAGAACCTTCAAGCTTTGGGCGGCCGAGGCCTAA
Full Trace Sequence: ctaacccggaagtagtaagttggggtagaagcgcggagtgagacgtctctgtgtaactggtacagaatcaccatgtcggatgatgaagggccccccgtggtgaaaaggtcgcgcatattctacggcagcctggccgacaaggagagggagcgtctggccaagggggaggccccgatgggcaggtcggcggtacgggcgggcatcgatgccgggaacattaacattagcggaggggagtcgtttgacctggaggagcacatcagcgagcggcaggccgaggtactggcggagtttgagcgcaggaagcgcgcgcggcagatcaacgtctccaccgatgactccgaggtgaaggcgtgtctccgggccctcggggagcccattacgctctttggggaggggccagcggaaaggagggagcgcctgaggaacgtgctgtccgtggtgggcaccgacgccttgaagaaaaccaagaaagacgaagagaagagcaagaagtcgagcgacgagtatcagcaaacctggtatcacgagggccccaatacgctgaaaatggctcgcctgtggctggcgcactactccctccctcgggctctgacgcggctgcaggctgccagggagcagcgggggatcccagaatccaccaggacttcccagaaacaggagctgaataagtctctgcagtccctgaataatttctgcagccaaatcggagacgaccggccgctgtccttctgccacttcagccccaactccaagatgttggccacaggctgctggagtgggctgtgcaagttatggtctgtgccagactgcaacctgatccgaaccctaagaggacacaacacaaacgtgggcgccatagtgttccaccccaaggccacaatctcattggaggagaaggatgtgaatttggcttcctgcgcggccgacggctccgtcaaactctggaacctggagagtgacgagccggtggctgatattgagggtcactcagtgcgggtggcgcgggtaacgtggcatccgtccggcaggttcctgggcaccacctgccatgatcgttcctggagactgtgggacctggaagcccaggaggaaatcctgcaccaggaggggcacagcaagggggtgtacgacatagacttccatacggacgggtcattagctgccaccgggggtctcgatgccttcggcagagtctgggatctacgtaccggccgctgcattatgttcctggaggggcaccttaaggagatctacgccgtcaacttctcccccaatgggtaccacgttgctaccggcagcggtgacaactcgtgcaaagtgtgggacctgcggcagcgccggtgcatctacacgatcccggcccaccagaacctcaccagctccgtcaagtttcagcccaccaatgggaattacctgctgaccggcgcctatgacaacacggccaaagtttggacacaccccctgtgggcgccattaaagactctcgctgggcatgaggggaaggtcatgggagttgacatttcaccggacggagaattaatcgccacctgttcctacgacagaaccttcaagctttgggcggccgaggcctaaaatgacccccatatagtgccattgggcggaatgttcccggggtggagataagtgatgccaggctgcggccctcctgctacaactcttatcacttcctgttgttaaactacaactcccatcacctcctgcacctttaataccagaactgtcattgccaggaactaagttttgtgttagatattgttatttttatattcaattaaaatcttcacaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MSDDEGPPVVKRSRIFYGSLADKERERLAKGEAPMGRSAVRAGIDAGNINISGGESFDLEEHISERQAEVLAEFERRKRARQINVSTDDSEVKACLRALGEPITLFGEGPAERRERLRNVLSVVGTDALKKTKKDEEKSKKSSDEYQQTWYHEGPNTLKMARLWLAHYSLPRALTRLQAAREQRGIPESTRTSQKQELNKSLQSLNNFCSQIGDDRPLSFCHFSPNSKMLATGCWSGLCKLWSVPDCNLIRTLRGHNTNVGAIVFHPKATISLEEKDVNLASCAADGSVKLWNLESDEPVADIEGHSVRVARVTWHPSGRFLGTTCHDRSWRLWDLEAQEEILHQEGHSKGVYDIDFHTDGSLAATGGLDAFGRVWDLRTGRCIMFLEGHLKEIYAVNFSPNGYHVATGSGDNSCKVWDLRQRRCIYTIPAHQNLTSSVKFQPTNGNYLLTGAYDNTAKVWTHPLWAPLKTLAGHEGKVMGVDISPDGELIATCSYDRTFKLWAAEA
Donor tissue: neurula