ORFeome > psmb6 – XORFeome 2.0

psmb6 – XORFeome 2.0

General Information

Species: Xenopus tropicalis proteasome (prosome, macropain) subunit, beta type, 6, mRNA (cDNA clone MGC:75674 IMAGE:5380062), complete cds
Gene Symbol: psmb6
Gene ID: 394756
ORF gb_acc: MG132825
ORF ID: 10173

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC061603

Library Location

Plate ID: GDExt11003
Well Location: A02

EST Sequences

Clone: MGC:75674 IMAGE:5380062
Trimmed Sequence: ATGGCTGCCATGAAACTCTTACAGGCTGCGGCTGCCGCTCCGCTCAGCGCGGCTCCTCCCGGAGATATGGACTGGATGGGGCGGGAAGTCAGCACCGGGACGACCATCATGGCGGTAGAGTTCGATGGGGGAGTTGTGATTGGCGCTGACTCCAGGACTACAACTGGGGCCTACATCGCTAACCGAGTGACTGACAAACTGACTCCTGTGCATGATCGGATCTTCTGCTGCCGCTCCGGTTCCGCCGCCGACACCCAGGCCATCGCTGATGCCGTAACCTACCAACTGGGCTTCCACAGTATCGAGCTGGACGGGCTCCCCCTGGTCCATACGGCCGCCAACCTGTTCAAGGAGATGTGTTACCGGTACCGGGAGGATCTGATGGCCGGGATCATAGTGGCCGGCTGGGACAAGAGGAAGGGCGGGCAGGTCTACACGGTGCCCATGGGAGGGATGATGGTCCACCAGCCGTTCTCCATCGGGGGCTCCGGCAGCTCCTACATTTACGGCTTCGTAGATTCCACGTACCGCTCAGGCATGACAAAGGAGGAGTGTCTGAAATTCACAGCCAATGCACTCGCCCTTGCCATGGAGAGAGACGGCTCCAGCGGGGGGGTGATCCGACTCGCCGCCATCACTGAGGGAGGAGTGGAGCGTCAGGTCATCCTGGGCAACGAGCTGCCCCGCTTCCCCTCGTCCTGA
Full Trace Sequence: cagagccagatctctcggtatttgaggatccctgaatcatggctgccatgaaactcttacaggctgcggctgccgctccgctcagcgcggctcctcccggagatatggactggatggggcgggaagtcagcaccgggacgaccatcatggcggtagagttcgatgggggagttgtgattggcgctgactccaggactacaactggggcctacatcgctaaccgagtgactgacaaactgactcctgtgcatgatcggatcttctgctgccgctccggttccgccgccgacacccaggccatcgctgatgccgtaacctaccaactgggcttccacagtatcgagctggacgggctccccctggtccatacggccgccaacctgttcaaggagatgtgttaccggtaccgggaggatctgatggccgggatcatagtggccggctgggacaagaggaagggcgggcaggtctacacggtgcccatgggagggatgatggtccaccagccgttctccatcgggggctccggcagctcctacatttacggcttcgtagattccacgtaccgctcaggcatgacaaaggaggagtgtctgaaattcacagccaatgcactcgcccttgccatggagagagacggctccagcgggggggtgatccgactcgccgccatcactgagggaggagtggagcgtcaggtcatcctgggcaacgagctgccccgcttcccctcgtcctgaaggttcccagttcttgtcttttgccccctctgctcttttgttattcagtcatgtgttaatgaataaaggctggtaccgacccgcggaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MAAMKLLQAAAAAPLSAAPPGDMDWMGREVSTGTTIMAVEFDGGVVIGADSRTTTGAYIANRVTDKLTPVHDRIFCCRSGSAADTQAIADAVTYQLGFHSIELDGLPLVHTAANLFKEMCYRYREDLMAGIIVAGWDKRKGGQVYTVPMGGMMVHQPFSIGGSGSSYIYGFVDSTYRSGMTKEECLKFTANALALAMERDGSSGGVIRLAAITEGGVERQVILGNELPRFPSS
Donor tissue: tadpole