ORFeome > psmc6 – XORFeome 2.0

psmc6 – XORFeome 2.0

General Information

Species: Xenopus tropicalis proteasome (prosome, macropain) 26S subunit, ATPase, 6, mRNA (cDNA clone MGC:76159 IMAGE:5335405), complete cds
Gene Symbol: psmc6
Gene ID: 394968
ORF gb_acc: MG132691
ORF ID: 9981

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC064227

Library Location

Plate ID: GDExt11001
Well Location: C08

EST Sequences

Clone: MGC:76159 IMAGE:5335405
Trimmed Sequence: ATGGCGGACCCACGGGAGAAGGCGCTGCAGGATTACAGGAAGAAATTGCTGGAGCACAAGGAGATAGATGGCCGGCTGAAGGAATTAAGAGAACAACTGAAAGAGCTCACCAAACAGTATGAAAAATCAGAGAATGACCTTAAAGCATTGCAGAGCGTTGGGCAGATTGTTGGGGAAGTTCTAAAGCAGCTTACTGAAGAAAAATTCATTGTTAAAGCAACGAATGGTCCAAGATATGTTGTTGGTTGTCGTCGACAGCTTGACAAAACTAAATTGAAGCCTGGAACAAGAGTTGCGCTAGATATGACTACTCTGACTATAATGCGTTATTTACCACGAGAAGTGGATCCCCTTGTGTACAACATGTCTCATGAGGACCCTGGAAATGTATCATACTCTGAAATAGGTGGACTTTCTGAACAGATCCGAGAACTCAGAGAGGTTATTGAGTTGCCACTTACAAATCCAGAATTGTTTCAGCGTGTAGGAATTATACCACCAAAGGGCTGTCTTCTCTATGGCCCCCCAGGTACTGGAAAAACTCTTCTTGCAAGAGCTGTTGCTAGCCAACTGGATTGCAATTTCCTAAAGGTTGTGTCTAGTTCAATTGTAGACAAGTACATTGGGGAAAGTGCACGACTCATTCGAGAAATGTTTAACTATGCCAGGGATCACCAGCCGTGTATAATTTTTATGGATGAAATTGATGCCATTGGTGGACGGCGGTTTTCTGAGGGGACCTCAGCTGACAGAGAGATTCAGAGAACTCTAATGGAGTTGCTGAATCAGATGGATGGGTTTGATACTTTGCACAGAGTAAAAATGATAATGGCTACTAACAGACCCGACACTTTGGATCCAGCCTTGTTGCGTCCTGGAAGACTTGACAGAAAAATACATATTGAGTTGCCCAATGAGCAGGCAAGGTTGGATATTTTGAAAATCCATGCTGGTCCCATAACAAAACATGGTGAAATTGATTATGAAGCCATAGTAAAGCTTTCAGATGGATTTAATGGGGCTGACCTTAGAAACGTCTGCACAGAAGCAGGGATGTTTGCAATCCGAGCAGACCGTGACTTTGTGGTCCAGGAAGACTTTATGAAAGCTGTTCGAAAAGTTGCAGATTCTAAGAAACTAGAGTCGAAACTAGACTACAAACCTGTCTAA
Full Trace Sequence: gcggcttctcatcatggcggacccacgggagaaggcgctgcaggattacaggaagaaattgctggagcacaaggagatagatggccggctgaaggaattaagagaacaactgaaagagctcaccaaacagtatgaaaaatcagagaatgaccttaaagcattgcagagcgttgggcagattgttggggaagttctaaagcagcttactgaagaaaaattcattgttaaagcaacgaatggtccaagatatgttgttggttgtcgtcgacagcttgacaaaactaaattgaagcctggaacaagagttgcgctagatatgactactctgactataatgcgttatttaccacgagaagtggatccccttgtgtacaacatgtctcatgaggaccctggaaatgtatcatactctgaaataggtggactttctgaacagatccgagaactcagagaggttattgagttgccacttacaaatccagaattgtttcagcgtgtaggaattataccaccaaagggctgtcttctctatggccccccaggtactggaaaaactcttcttgcaagagctgttgctagccaactggattgcaatttcctaaaggttgtgtctagttcaattgtagacaagtacattggggaaagtgcacgactcattcgagaaatgtttaactatgccagggatcaccagccgtgtataatttttatggatgaaattgatgccattggtggacggcggttttctgaggggacctcagctgacagagagattcagagaactctaatggagttgctgaatcagatggatgggtttgatactttgcacagagtaaaaatgataatggctactaacagacccgacactttggatccagccttgttgcgtcctggaagacttgacagaaaaatacatattgagttgcccaatgagcaggcaaggttggatattttgaaaatccatgctggtcccataacaaaacatggtgaaattgattatgaagccatagtaaagctttcagatggatttaatggggctgaccttagaaacgtctgcacagaagcagggatgtttgcaatccgagcagaccgtgactttgtggtccaggaagactttatgaaagctgttcgaaaagttgcagattctaagaaactagagtcgaaactagactacaaacctgtctaacatagacaaaagactgcatgggtgatatgtggttatgttagaggttcatatgttcctcctgggtctggtctttattaaaagtacataaaacattgtcagatttagtaatccaataatttctggaacaagtctgctacagaatgtttcttttgtctgtatttcaatagttgcgcatccactgcagttccatttacaggaagatttgcattgcaaaacactcactgagtgatcaaggtagagatgtgctgaaagggaaacaacatagcagattttaggaaagttaatgtgtttcgtaaaaagtattttatatcaactgacttttgtctttttttctttccaagctaaaataaataacatttaaatgcgaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MADPREKALQDYRKKLLEHKEIDGRLKELREQLKELTKQYEKSENDLKALQSVGQIVGEVLKQLTEEKFIVKATNGPRYVVGCRRQLDKTKLKPGTRVALDMTTLTIMRYLPREVDPLVYNMSHEDPGNVSYSEIGGLSEQIRELREVIELPLTNPELFQRVGIIPPKGCLLYGPPGTGKTLLARAVASQLDCNFLKVVSSSIVDKYIGESARLIREMFNYARDHQPCIIFMDEIDAIGGRRFSEGTSADREIQRTLMELLNQMDGFDTLHRVKMIMATNRPDTLDPALLRPGRLDRKIHIELPNEQARLDILKIHAGPITKHGEIDYEAIVKLSDGFNGADLRNVCTEAGMFAIRADRDFVVQEDFMKAVRKVADSKKLESKLDYKPV
Donor tissue: tailbud