ORFeome > pygb – XORFeome 2.0

pygb – XORFeome 2.0

General Information

Species: Xenopus tropicalis phosphorylase, glycogen; brain, mRNA (cDNA clone MGC:75996 IMAGE:5384504), complete cds
Gene Symbol: pygb
Gene ID: 431680
ORF gb_acc:
ORF ID: 10988

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC068296

Library Location

Plate ID: GDExt11009
Well Location: C12

EST Sequences

Clone: MGC:75996 IMAGE:5384504
Trimmed Sequence: ATGGCCGCCCCTCTATCCGACTCCGACAAGAAGAAGCAGATCAGCGTGAGGGGCATCGCCGGCCTGGGGGATGTGTCCGAGGTCCGGAAAAGCTTTAACCGACATCTGCACTTCACCCTAGTGAAGGACAGGAACGTGTCCACCCCCCGGGACTATTACTTCGCCCTGGCGCACACTGTGCGGGATCACCTGGTGGGGCGATGGATCCGGACGCAGCAGTATTACTACGAGAAGGACCCCAAGCGAATTTATTATCTTTCCCTGGAATTCTACATGGGTCGCACCCTGCAGAACACAATGCTAAATCTAGGACTGCAGCATGCCTGTGATGAAGCCATTTATCAGCTGGGCCTGGATATGGAGGAGCTTGAGGAGATAGAAGAGGATGCAGGTCTCGGGAACGGTGGATTGGGGCGCCTGGCAGCTTGCTTCCTGGACTCTATGGCAACACTTGGACTTGCGGCTTATGGGTATGGAATCCGATATGAATTTGGCATATTCAACCAAAGGATTTTAAATGGCTGGCAGGTTGAGGAAGCAGATGATTGGTTGCGGTATGGAAACCCTTGGGAAAAAGCTCGCCCAGAATTCATGCTCCCTGTCCATTTCTTTGGCAGAGTGGAGCACACAGCTGAAGGTGCCAAGTGGGTTGACACTCAGATTGTTTTGGCAATGCCTTATGACACACCTGTCCCTGGATACAAAAATAACACAGTGAACACCATGAGGCTGTGGTCAGCCAAGGCCCCCAATGAGTTCAACCTACAAGAATTTAATGTTGGTGACTACATAGAGGCCGTGCTGGACAGAAATCTGGCTGAAAACATCTCCCGAGTATTGTACCCTAATGACAATTTCTTTGAAGGCAAAGAGCTGCGGCTGAAGCAGGAGTACTTTGTTGTGGCTGCCACACTACAGGATATCATCAGACGGTTCAAATCTTCTAAGTTTGGATGTCGGGACCCAGTTAGAACCTGTTTCGATACATTTCCAGACAAGGTTGCAATACAGCTGAACGACACTCATCCTGCACTCGCCATCCCAGAACTTATGAGGATTTTAGTAGATGTGGAAAAAATGGAATGGGACAGGGCCTGGGAGGTCACCAAGAAGACCTGTGCTTACACAAATCACACAGTACTGCCCGAGGCTTTGGAACGATGGCCTGTGCACTTGTTTGAGAAGCTGCTGCCACGTCACCTGGAGATTATCTATGCAATCAACCAAAAACATCTTGACGAAGTGGCAACCATGTACCCAGGGGATGTGGATCGCCTGAGAAGAATGTCTGTCATTGAAGAAGGAGATTGCAAAAGGATCAACATGGCCAATTTGTGTGTAATTGGTTCTCATGCTGTCAATGGAGTGGCCAGGATTCACTCGGAAATAGTTAAGAATTCTGTTTTCAAAGATTTCTACGACCTTGAACCAAACAAGTTTCAGAACAAGACCAATGGCATCACTCCAAGGCGCTGGCTTATGCTGTGCAACCCAGGCTTGTCGGATATCATTGCTGAGAAAATTGGAGAGGATTTTGTGACAGACTTGAGCCAGTTGCGGAAGTTACTGGATTTTGTCAATGATGAAAGCTTTGTGCATGATGTGGCCAAGGTCAAGCAGGAAAACAAACTGAAGTTTGCAGCCTACTTGGAGCAGGAATACAAGGTCAAGATAAACCCTTCTTCTGTGTTTGATGTGCAAGTCAAGAGAATCCATGAATACAAGAGGCAGCTGCTCAATTGCTTACACATCATTACTCTGTACAACAGAATAAAGAAAGATCCATCCAAGATCTTTGTTCCAAGGACTGTTATGATTGGAGGAAAGGCAGCTCCTGGTTACCATATGGCTAAAATGATCATCAAGTTAATCAACTCCATTGCAAGCATTGTGAATAACGATCCAGTTATCGGTGACAGACTGAAGGTCATTTTCCTGGAAAATTATCGAGTGTCCCTTGCAGAGAAAGTTATCCCCGCAGCCGACTTGTCTCAGCAGATCTCTACTGCCGGCACTGAGGCTTCCGGCACAGGGAACATGAAGTTTATGTTGAATGGAGCCTTGACTATAGGAACCATGGACGGGGCCAATGTGGAGATGGCAGAAGAGGCGGGAGAAGAAAACTTGTTCATCTTTGGCATGAGAGTGGATGATGTGGAAGCTCTTGACAAGAAGGGGTACAGTGCTAAGGCGTACTATGATAGAATCCCAGAGCTGCGACAGGTGATTGACCAGATCAGGGATGGACATTTCTCCCCCAGAGAACCTGATCTTTTCAAGGATGTTGTCAATATGCTGATGAACCATGACAGGTTTAAGGTGTTTGCTGACTATGAAGATTATATCAAATGCCAAGAGAAAGTGGACCAGTTATACATGAACCCCAGGGAATGGACAAAGAAGGTGATCAGAAACATCGCCTGCTCCGGCAAGTTCTCCAGTGACAGGACCATTAGCGAATATGCAACAGAAATCTGGGGAGTGGAGCCATCAGCAGTGAAGATCCCACCACCCAACATACCGAGGGAGTAG
Full Trace Sequence: ctccctggtaacccctctctgtaggcagcgacatggccgcccctctatccgactccgacaagaagaagcagatcagcgtgaggggcatcgccggcctgggggatgtgtccgaggtccggaaaagctttaaccgacatctgcacttcaccctagtgaaggacaggaacgtgtccaccccccgggactattacttcgccctggcgcacactgtgcgggatcacctggtggggcgatggatccggacgcagcagtattactacgagaaggaccccaagcgaatttattatctttccctggaattctacatgggtcgcaccctgcagaacacaatgctaaatctaggactgcagcatgcctgtgatgaagccatttatcagctgggcctggatatggaggagcttgaggagatagaagaggatgcaggtctcgggaacggtggattggggcgcctggcagcttgcttcctggactctatggcaacacttggacttgcggcttatgggtatggaatccgatatgaatttggcatattcaaccaaaggattttaaatggctggcaggttgaggaagcagatgattggttgcggtatggaaacccttgggaaaaagctcgcccagaattcatgctccctgtccatttctttggcagagtggagcacacagctgaaggtgccaagtgggttgacactcagattgttttggcaatgccttatgacacacctgtccctggatacaaaaataacacagtgaacaccatgaggctgtggtcagccaaggcccccaatgagttcaacctacaagaatttaatgttggtgactacatagaggccgtgctggacagaaatctggctgaaaacatctcccgagtattgtaccctaatgacaatttctttgaaggcaaagagctgcggctgaagcaggagtactttgttgtggctgccacactacaggatatcatcagacggttcaaatcttctaagtttggatgtcgggacccagttagaacctgtttcgatacatttccagacaaggttgcaatacagctgaacgacactcatcctgcactcgccatcccagaacttatgaggattttagtagatgtggaaaaaatggaatgggacagggcctgggaggtcaccaagaagacctgtgcttacacaaatcacacagtactgcccgaggctttggaacgatggcctgtgcacttgtttgagaagctgctgccacgtcacctggagattatctatgcaatcaaccaaaaacatcttgacgaagtggcaaccatgtacccaggggatgtggatcgcctgagaagaatgtctgtcattgaagaaggagattgcaaaaggatcaacatggccaatttgtgtgtaattggttctcatgctgtcaatggagtggccaggattcactcggaaatagttaagaattctgttttcaaagatttctacgaccttgaaccaaacaagtttcagaacaagaccaatggcatcactccaaggcgctggcttatgctgtgcaacccaggcttgtcggatatcattgctgagaaaattggagaggattttgtgacagacttgagccagttgcggaagttactggattttgtcaatgatgaaagctttgtgcatgatgtggccaaggtcaagcaggaaaacaaactgaagtttgcagcctacttggagcaggaatacaaggtcaagataaacccttcttctgtgtttgatgtgcaagtcaagagaatccatgaatacaagaggcagctgctcaattgcttacacatcattactctgtacaacagaataaagaaagatccatccaagatctttgttccaaggactgttatgattggaggaaaggcagctcctggttaccatatggctaaaatgatcatcaagttaatcaactccattgcaagcattgtgaataacgatccagttatcggtgacagactgaaggtcattttcctggaaaattatcgagtgtcccttgcagagaaagttatccccgcagccgacttgtctcagcagatctctactgccggcactgaggcttccggcacagggaacatgaagtttatgttgaatggagccttgactataggaaccatggacggggccaatgtggagatggcagaagaggcgggagaagaaaacttgttcatctttggcatgagagtggatgatgtggaagctcttgacaagaaggggtacagtgctaaggcgtactatgatagaatcccagagctgcgacaggtgattgaccagatcagggatggacatttctcccccagagaacctgatcttttcaaggatgttgtcaatatgctgatgaaccatgacaggtttaaggtgtttgctgactatgaagattatatcaaatgccaagagaaagtggaccagttatacatgaaccccagggaatggacaaagaaggtgatcagaaacatcgcctgctccggcaagttctccagtgacaggaccattagcgaatatgcaacagaaatctggggagtggagccatcagcagtgaagatcccaccacccaacataccgagggagtagaggccgcagggtgcatgtgctcgctgttctctgctgatagttgtgttggtaccggattagtacttgtccaccagttgtgacttagcaccattttccctgtcaaagcttagtctctgggaaatacttgtgtggtccttattggggctctcacaggtaaccggctgccactgacagtcttgcatagctctctgctcaaccaaaccagattagcagcacatctgtaaatcctcctcccacaggcttgcttatatatatatatatatactctctattacacagcagaacctctgtgtatctgtgtagctaggaatctttacttgtacttccgcatttgctggcctgcaactcacaacttttagcagctgggcattgtagcatagcagtgtgagcttttagaaatgagttcccttgaaatagccactgccggtgattgtaaggatagggcagtgctgcccagaatcctgagtactgtattggaggggatggctagcagggaacacggtgctgtagatacagtctagccacaaggtgctaaaggtgctaaggaaccaacactcactgatccgaagtaagattcacccagaatgtagtctctccgtgataccaataccgctccgtaccacttctgttctgaggaaggaagagaacaagcgtctgtgtctgtagcttttcatgtctttgtctttgtggagacactttagtgtgtgtgatttactaaaaagtactgtatttcttacagaagatttgcacgttaactctagtttcatgctttcagcattgattcttttcccctcagggaagcagaactcatgtctctctggctgcatccagtggccgttatggatgctgaaagttgcagttcagaagcaggagagacactgttcagccatcccttattttagttgacaattatttttaatgtgtgttttgcacagaagctactgaattcactgctgttgtttcataccatttcactctatgggacataggaggctcagtgccaggaggctgctgggtcatgataagcagtgcaacatgtctgcagttcagtagtattccccatttacaggagggggaagtacttgcattttgcccttatggaagcagtaaagaagaatatgttctgtgggcagcactatgccacaccattataccttactgcagttgtagggctaagtctaatttatgatactaaaaataataaggcatattgggaataacaagcatgaccaacatctttactgctactggggaaccactcagggctttgtactataatcatcaaatttgtgggtaataaacccaatattgccggttgtaagcagctaatgatgatttgcctgggagccaagcacatggggggatgggagggtctttggtttagttgtctttatgagcccagccatgctcagcaatgcactgcatgccccattgagtttcagcgtagagaactgctgccgttctgcgtagcggcccctaggtagggcaaaggccagacccagctgcattacaccacttacctggccttccttcatctcctgcattttatatttgaggtactgaaagattatatacaatatatattttaatgaaacggttttattcattttattattctgagaaaacatgatcagtatgtcagcagggaccacattgatttgtgtgctatcctattaggcatcaggattctagcaactgatttagaacctgtgcatgtctttcagtaggactaatgcccaatcagcaccccattcgcccaacccatacattccttttttaccaatggagcatgtaacgcattgctgagcagccccaagcacatagctgcacccagagtgcatttcagcgggtcattgctcccaagtggcaggtatgagttggaagagaataatatataggaaactaatatacttactgggcattagaagtggaaaagggagatttgtgagcaatgactttactaaccaagcaaaatggtggcatagccatactgctgagcgagtgtatggagtctgatggctacagactactgccttgtaaataataatgtatgcacagcagatccgtattgtgttccttcttccctgtgtcacgcattgccctgagcttccaacgtctaataaacatccatccaacaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MAAPLSDSDKKKQISVRGIAGLGDVSEVRKSFNRHLHFTLVKDRNVSTPRDYYFALAHTVRDHLVGRWIRTQQYYYEKDPKRIYYLSLEFYMGRTLQNTMLNLGLQHACDEAIYQLGLDMEELEEIEEDAGLGNGGLGRLAACFLDSMATLGLAAYGYGIRYEFGIFNQRILNGWQVEEADDWLRYGNPWEKARPEFMLPVHFFGRVEHTAEGAKWVDTQIVLAMPYDTPVPGYKNNTVNTMRLWSAKAPNEFNLQEFNVGDYIEAVLDRNLAENISRVLYPNDNFFEGKELRLKQEYFVVAATLQDIIRRFKSSKFGCRDPVRTCFDTFPDKVAIQLNDTHPALAIPELMRILVDVEKMEWDRAWEVTKKTCAYTNHTVLPEALERWPVHLFEKLLPRHLEIIYAINQKHLDEVATMYPGDVDRLRRMSVIEEGDCKRINMANLCVIGSHAVNGVARIHSEIVKNSVFKDFYDLEPNKFQNKTNGITPRRWLMLCNPGLSDIIAEKIGEDFVTDLSQLRKLLDFVNDESFVHDVAKVKQENKLKFAAYLEQEYKVKINPSSVFDVQVKRIHEYKRQLLNCLHIITLYNRIKKDPSKIFVPRTVMIGGKAAPGYHMAKMIIKLINSIASIVNNDPVIGDRLKVIFLENYRVSLAEKVIPAADLSQQISTAGTEASGTGNMKFMLNGALTIGTMDGANVEMAEEAGEENLFIFGMRVDDVEALDKKGYSAKAYYDRIPELRQVIDQIRDGHFSPREPDLFKDVVNMLMNHDRFKVFADYEDYIKCQEKVDQLYMNPREWTKKVIRNIACSGKFSSDRTISEYATEIWGVEPSAVKIPPPNIPRE
Donor tissue: neurula