ORFeome > rab11b.2 – XORFeome 2.0

rab11b.2 – XORFeome 2.0

General Information

Species: Xenopus tropicalis RAB11B, member RAS oncogene family, gene 2, mRNA (cDNA clone MGC:88884 IMAGE:6998325), complete cds
Gene Symbol: rab11b.2
Gene ID: 448210
ORF gb_acc: MG134068
ORF ID: 11688

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC075268

Library Location

Plate ID: GDExt11016
Well Location: G11

EST Sequences

Clone: MGC:88884 IMAGE:6998325
Trimmed Sequence: ATGGGGACCCGTGACGATGAGTACGATTATTTATTCAAAGTTGTTCTGATCGGAGACTCCGGAGTGGGTAAGAGTAACCTGCTGTCTCGTTTTACTCGTAATGAATTTAACTTGGAGAGTAAAAGTACCATCGGTGTGGAATTTGCCACCCGGAGCATCCAGGTTGATGGCAAGACTATAAAGGCTCAGATCTGGGACACGGCTGGACAAGAGAGATACAGAGCCATCACATCTGCTTATTACAGGGGTGCAGTGGGAGCACTGTTAGTTTATGACATTGCTAAACATCTGACCTATGAAAATGTGGAGCGCTGGCTCAAAGAGCTGAGGGACCATGCAGACAACAACATTGTCATAATGCTGGTTGGGAACAAAAGCGACCTGCGTCACCTTCGTGCTGTCCCCACAGATGAGGCTCGTGCATTTGCAGAAAAGAATAACTTATCATTCATCGAAACTTCCGCTTTGGATTCAACCAATGTGGAGGAGTCATTTAAGAACATCCTGACAGAGATCTATCGCATAGTGTCACAGAAACAGATGGCGGACAGGGCAGCCCATGAAGATTCTCCTGGGAATAATGTGGTTGATATCAGTGTCACACCCACCATGGATGGGCAAAGATCCATTAAACTCCAGTGCTGTCAGAACCTGTGA
Full Trace Sequence: cgggacatcgcgacatggggacccgtgacgatgagtacgattatttattcaaagttgttctgatcggagactccggagtgggtaagagtaacctgctgtctcgttttactcgtaatgaatttaacttggagagtaaaagtaccatcggtgtggaatttgccacccggagcatccaggttgatggcaagactataaaggctcagatctgggacacggctggacaagagagatacagagccatcacatctgcttattacaggggtgcagtgggagcactgttagtttatgacattgctaaacatctgacctatgaaaatgtggagcgctggctcaaagagctgagggaccatgcagacaacaacattgtcataatgctggttgggaacaaaagcgacctgcgtcaccttcgtgctgtccccacagatgaggctcgtgcatttgcagaaaagaataacttatcattcatcgaaacttccgctttggattcaaccaatgtggaggagtcatttaagaacatcctgacagagatctatcgcatagtgtcacagaaacagatggcggacagggcagcccatgaagattctcctgggaataatgtggttgatatcagtgtcacacccaccatggatgggcaaagatccattaaactccagtgctgtcagaacctgtgatgaaatgtaaataactgggtattgtgtagaagatcttatgaactgatgttaggataggcagaattggtggaggaagcagggcaaaagaagtcatatccaggagtcccatggtgctcaccttcctgcctcaccactaatcagtgccaattgcaatgttatggctgctacatcctgatctactggacctcaggatgtagacgttatatcaaggtttgaaggcaaaatatttaaaagagtgtatgtattcatatataaacattttgtattggtgcaaaataagcaccatttttgagtttgtaactacaatggcagcagacaaaccaataaaaatacaaaggtaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MGTRDDEYDYLFKVVLIGDSGVGKSNLLSRFTRNEFNLESKSTIGVEFATRSIQVDGKTIKAQIWDTAGQERYRAITSAYYRGAVGALLVYDIAKHLTYENVERWLKELRDHADNNIVIMLVGNKSDLRHLRAVPTDEARAFAEKNNLSFIETSALDSTNVEESFKNILTEIYRIVSQKQMADRAAHEDSPGNNVVDISVTPTMDGQRSIKLQCCQNL
Donor tissue: