ORFeome > rabgef1 – XORFeome 2.0

rabgef1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis RAB guanine nucleotide exchange factor (GEF) 1, mRNA (cDNA clone MGC:75593 IMAGE:5379206), complete cds
Gene Symbol: rabgef1
Gene ID: 394956
ORF gb_acc: MG132799
ORF ID: 10132

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC064156

Library Location

Plate ID: GDExt11002
Well Location: C02

EST Sequences

Clone: MGC:75593 IMAGE:5379206
Trimmed Sequence: ATGAGCCTCAAAACAGAGCGCCGCGGCATCCATGTTGACCAATCAGAACTTCTGTGTAAGAAAGGGTGTGGCTACTATGGGAACCCAGCCTGGCAAGGATTTTGCTCCAAGTGCTGGAGGGAGGAGTACCAGAAAGCTCGGCAGAAGCAAATCCAGGATGACTGGGAATTGGCAGAACGCCTGCAACGTGAAGAAGAGGAGGCATATCCAAGCAGCCAGGGAGCCCAGGCAGGGCCACAATCTCTTACGTTTTCAAAGTTTGAAGAAAAGAAATCCAATGAAAAGACCAGGAAAGTAACTACAGTGAAAAAATTCTTTACCGCTTCCACTAAAAGCCTCCCAAAGAAAGATATAAAAGAAGCAAAATCCCCAAGCCCTTCTCTGAGCCGCCAGTATAGCTTGGAAACTGACCGCGTGTCCAAGGATTTTATTGAGTTTTTAAAGACTTACCAGAAAGCAGGACATGACGTGTACAAAATGTCCAAAATCTTCTTGGAAGCCATGTATCACAAAAGGGAATCAAATATTGACGAACAATCTGAATTTACCCAGGACTTTTATCAAAACACAGCAGAGAAGTTGCAGATGTATTGGAAGGTGTCCCCTGATAAAGTTGAGAAAGTGACGGATCAAATTGAGCGGTTCATAATGACTCGTCTCTACAAGCACGTGTTTTGCCCAGAAACCACAGATGATGAGAAGAAGGACCTCACAGTCCAAAAGAGAATCCGGGCTTTACACTGGGTAACTCCTCAGATGCTTTGTGTTCCTGTAAATGAAGATATCGCAGAGGTGTCTGACATGGTGGTAAAGGCTATAACAGTGCTGCGCTGTGGCCTTCATCGAGAAACTAGATGCACAGTCACTGAATTTAAGCGAAGAAGAGTTCAGCAGGTACATGTCTGGGCAGGCTTCTCCAAAAAAGCAAGACCTAGAGAACTGGCCCGCAGACACATGCCCTGGTGTAAAACAGATGCACAGAAACCTTGA
Full Trace Sequence: gggattttctgacaggcaggagggtgaggcttgtagtttacagctttgccgaaggcgaagatgagcctcaaaacagagcgccgcggcatccatgttgaccaatcagaacttctgtgtaagaaagggtgtggctactatgggaacccagcctggcaaggattttgctccaagtgctggagggaggagtaccagaaagctcggcagaagcaaatccaggatgactgggaattggcagaacgcctgcaacgtgaagaagaggaggcatatccaagcagccagggagcccaggcagggccacaatctcttacgttttcaaagtttgaagaaaagaaatccaatgaaaagaccaggaaagtaactacagtgaaaaaattctttaccgcttccactaaaagcctcccaaagaaagatataaaagaagcaaaatccccaagcccttctctgagccgccagtatagcttggaaactgaccgcgtgtccaaggattttattgagtttttaaagacttaccagaaagcaggacatgacgtgtacaaaatgtccaaaatcttcttggaagccatgtatcacaaaagggaatcaaatattgacgaacaatctgaatttacccaggacttttatcaaaacacagcagagaagttgcagatgtattggaaggtgtcccctgataaagttgagaaagtgacggatcaaattgagcggttcataatgactcgtctctacaagcacgtgttttgcccagaaaccacagatgatgagaagaaggacctcacagtccaaaagagaatccgggctttacactgggtaactcctcagatgctttgtgttcctgtaaatgaagatatcgcagaggtgtctgacatggtggtaaaggctataacagtgctgcgctgtggccttcatcgagaaactagatgcacagtcactgaatttaagcgaagaagagttcagcaggtacatgtctgggcaggcttctccaaaaaagcaagacctagagaactggcccgcagacacatgccctggtgtaaaacagatgcacagaaaccttgacctacttacccagctgtccaagagacaagagcatattgtaaatggggctaagaaactagagaaagaccttattgactggacggatgacgtcaccaaggaagtcaaggacattgtagaaaaatacccactgaacattaaaacagccagccaggccctcgcagcacttgagtcagaaaatatagaagatgataagctgccccctccactgcagcctcaagtctatgcaggataatagactcagcctagaagacacaaacacatacaattactcctattaaactggtgcagcagtaatttactgatttttggagaacttggatcagtttattgcagatcctggagagatcaggttttttttaaaatgaagacttgtgacggtacaaagtttctttggccttgtggtttgcttgggaaagctatttattaatatggattatacagggctgtatgttacagaaagcaatgattattcactaattcttttaacatgataaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MSLKTERRGIHVDQSELLCKKGCGYYGNPAWQGFCSKCWREEYQKARQKQIQDDWELAERLQREEEEAYPSSQGAQAGPQSLTFSKFEEKKSNEKTRKVTTVKKFFTASTKSLPKKDIKEAKSPSPSLSRQYSLETDRVSKDFIEFLKTYQKAGHDVYKMSKIFLEAMYHKRESNIDEQSEFTQDFYQNTAEKLQMYWKVSPDKVEKVTDQIERFIMTRLYKHVFCPETTDDEKKDLTVQKRIRALHWVTPQMLCVPVNEDIAEVSDMVVKAITVLRCGLHRETRCTVTEFKRRRVQQVHVWAGFSKKARPRELARRHMPWCKTDAQKP
Donor tissue: tailbud