ORFeome > rad54l – XORFeome 2.0

rad54l – XORFeome 2.0

General Information

Species: Xenopus tropicalis RAD54-like (S. cerevisiae), mRNA (cDNA clone MGC:69368 IMAGE:5309406), complete cds
Gene Symbol: rad54l
Gene ID: 407922
ORF gb_acc:
ORF ID: 10808

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC067986

Library Location

Plate ID: GDExt11008
Well Location: E01

EST Sequences

Clone: MGC:69368 IMAGE:5309406
Trimmed Sequence: ATGAGAAGGAGTCTTGCTCCAAGTCAGTTGGCAAAGAGAAAGCAGGGTAGCTCATCTGAGGATGAGGAATGGTGTGAAGATGCGGTTCCAAAGAGAAAACGTTTAAGCAGTAACAAGGACATTCGAGAGAACTGGATTTCACCTTTTCGGAAACCTCTTGCACAAGTAACAAATAGGCCAACGTGTCTTGATAGCAAGCAACATGAGGCCTTTATTCGAAGCATATTGTCAAAACCATTTAAGATCCCCATTCCAAACTATCAAGGAGGCCTAGGATTGCGGGCTTTGGGAATAAAAAAAGCTGGTATAAGAAGAGCCCTCCATGATCCATTTGAAGAAGGTGCTTTGGTTCTTTATGAGCCCCCTCAGCTTAGTGCACATGATCTGCTCAAAGTGGACAAAGAGAAAGTTCCAGTCCATGTGGTGGTTGATCCAGTACTTGGGAAGGTGTTAAGACCACATCAGAGAGAAGGTGTGAAATTTCTTTGGGAATGTGTGACAGGACGGCGTATCTCTGGAAGTCATGGAAGCATCATGGCAGATGAGATGGGGCTAGGAAAGACTCTACAGTGCATCACTCTTATCTGGACCTTACTCAGACAAAGTCCAGATGCCAAACCAGAAATTGAAAAGGCAGTAGTGGTTTGTCCATCCAGTCTGGTCAAAAATTGGTACAATGAAGTTAGCAAGTGGCTTGGAGGAAGAATACAGCCTTTGGCTATTGATGGGGGATCCAAGGAGGAGATCGACAAAAAACTAAGCGGCTTTATGAATCAGCATGGAATGCGGGTCCCTTCTGCAATTTTAATCATTTCCTATGAGACATTTCGCCTGCATGCTGAAGTTCTGCACAGAGGCAGTGTGGGGCTGGTCATATGCGACGAGGGACATAGACTAAAGAATTCTGAGAATCAAACTTACCAAGCTCTCAACAGTCTTAACACTGTACGACGTGTGCTAATCTCTGGAACACCCATTCAGAATGACCTCTTGGAATACTTCAGCCTGGTGCACTTTGTTAATGCTGGAATTCTTGGGACAGCTCAAGAGTTCAAGAAACGCTTTGAAATTCCTATTTTAAAGGGAAGAGATGCAGATGCCAGTGCTGCTGACAGACAGAAAGGAGAGGAAAAACTCAAAGAATTGATCGGTGTTGTGAATAGGTGTCTCATTAGAAGAACGTCAGACATTTTGTCAAAGTACCTGCCAGTAAAGATTGAACAGGTGGTCTGTTGCAGATTAACTCCTTTGCAATCAGAACTCTACAAGCTGTTTTTAAAACAAGCAAAACCTGCAGAAGACTTAAACGAGGGGAAAATAAGTGTTTCTTCATTGTCTTCCATTACCTCTTTAAAAAAGCTTTGCAATCATCCTTCACTGATTTATGAGAAGTGTGTGGAAGAAGAAGAGGGCTTTCAGGGAGCCTTGAATCTATTCCCTTCTGGTTACAGCACTAAATCTGTGGAGCCACAATTATCTGGGAAAATGCTTGTTCTGGATTATATCCTGGCAGTTACACGAAGCACTAGCAGTGATAAGGTGGTTTTGGTCTCTAACTACACCCAAACACTGGACTTGTTTGAGAAATTGTGTCGGACAAGGAGATATCTTTATGTGCGCTTGGATGGGACCATGTCAATAAAGAAGCGAGCAAAAATAGTGGAACGTTTTAACAGCCCCTCAAGTCCTGAATTTATCTTTATGCTGAGCAGTAAAGCTGGTGGCTGCGGTTTAAATTTAATAGGCGCTAACAGATTAGTGATGTTTGACCCAGACTGGAACCCGGCAAATGATGAGCAGGCGATGGCTCGTGTATGGAGAGATGGCCAGAAAAAGACCTGTTTTATCTATAGACTACTTTCGACTGGGACAATTGAAGAAAAAATCTTTCAGCGCCAAACCCACAAGAAAGCACTGAGCAGCTGTGTGGTAGATGAGGAGCAGGATGTGGAGAGACACTTCTCCATTGGAGAGCTAAAGGAACTCTTCATTCTTAATGAGAACACAACCAGTGATACCCATGACAAATTTAAGTGTCGTCGCTGTGTGAATGGGCATCAAGTCAGACCTCCTCCGGATGGTACAGACTGCACCTCAGACCTCTCCCAGTGGAATCACTGTGCTGACAAGCGAGGGCTGCAAGACCCAGTTCTTGTGTCTGCTTGGGATGCTGCCATCACATTTACATTCCACCACCAGTCCCATGAGGAGCAAAGGGGTGTTCTTTAG
Full Trace Sequence: gagtttaatgtgaaaatggaataggctggggcaatgttgttgtatgtactgcaaaataaaggaaaacaaatctgcaactggccgaatcctgcccaccccgtgtgttgttacaaggatgagtaccatgtttcctgtctgagtgaaaatgagaaggagtcttgctccaagtcagttggcaaagagaaagcagggtagctcatctgaggatgaggaatggtgtgaagatgcggttccaaagagaaaacgtttaagcagtaacaaggacattcgagagaactggatttcaccttttcggaaacctcttgcacaagtaacaaataggccaacgtgtcttgatagcaagcaacatgaggcctttattcgaagcatattgtcaaaaccatttaagatccccattccaaactatcaaggaggcctaggattgcgggctttgggaataaaaaaagctggtataagaagagccctccatgatccatttgaagaaggtgctttggttctttatgagccccctcagcttagtgcacatgatctgctcaaagtggacaaagagaaagttccagtccatgtggtggttgatccagtacttgggaaggtgttaagaccacatcagagagaaggtgtgaaatttctttgggaatgtgtgacaggacggcgtatctctggaagtcatggaagcatcatggcagatgagatggggctaggaaagactctacagtgcatcactcttatctggaccttactcagacaaagtccagatgccaaaccagaaattgaaaaggcagtagtggtttgtccatccagtctggtcaaaaattggtacaatgaagttagcaagtggcttggaggaagaatacagcctttggctattgatgggggatccaaggaggagatcgacaaaaaactaagcggctttatgaatcagcatggaatgcgggtcccttctgcaattttaatcatttcctatgagacatttcgcctgcatgctgaagttctgcacagaggcagtgtggggctggtcatatgcgacgagggacatagactaaagaattctgagaatcaaacttaccaagctctcaacagtcttaacactgtacgacgtgtgctaatctctggaacacccattcagaatgacctcttggaatacttcagcctggtgcactttgttaatgctggaattcttgggacagctcaagagttcaagaaacgctttgaaattcctattttaaagggaagagatgcagatgccagtgctgctgacagacagaaaggagaggaaaaactcaaagaattgatcggtgttgtgaataggtgtctcattagaagaacgtcagacattttgtcaaagtacctgccagtaaagattgaacaggtggtctgttgcagattaactcctttgcaatcagaactctacaagctgtttttaaaacaagcaaaacctgcagaagacttaaacgaggggaaaataagtgtttcttcattgtcttccattacctctttaaaaaagctttgcaatcatccttcactgatttatgagaagtgtgtggaagaagaagagggctttcagggagccttgaatctattcccttctggttacagcactaaatctgtggagccacaattatctgggaaaatgcttgttctggattatatcctggcagttacacgaagcactagcagtgataaggtggttttggtctctaactacacccaaacactggacttgtttgagaaattgtgtcggacaaggagatatctttatgtgcgcttggatgggaccatgtcaataaagaagcgagcaaaaatagtggaacgttttaacagcccctcaagtcctgaatttatctttatgctgagcagtaaagctggtggctgcggtttaaatttaataggcgctaacagattagtgatgtttgacccagactggaacccggcaaatgatgagcaggcgatggctcgtgtatggagagatggccagaaaaagacctgttttatctatagactactttcgactgggacaattgaagaaaaaatctttcagcgccaaacccacaagaaagcactgagcagctgtgtggtagatgaggagcaggatgtggagagacacttctccattggagagctaaaggaactcttcattcttaatgagaacacaaccagtgatacccatgacaaatttaagtgtcgtcgctgtgtgaatgggcatcaagtcagacctcctccggatggtacagactgcacctcagacctctcccagtggaatcactgtgctgacaagcgagggctgcaagacccagttcttgtgtctgcttgggatgctgccatcacatttacattccaccaccagtcccatgaggagcaaaggggtgttctttagctttatttaatcatctgctgaaagagtgaaggtgggagactggagagatgaaaaatcctttttatattctgagttgcaggcccttatgttatgtttcctgctttaatgttgtggcccatcaggttaacctacatctttttaccactgttccttaatggcagtatgaaactctgaggcaagagcatcatgtcctaatgtttattttgttgtttttcaaatcgcccatattattgtatgctatttggaggtaacctgtcagtgcatggacacaatatacagacttcctccttacagctcattgctgccatctgctgtaccctatgggtaggctaggcaccagtcactaggctactgcagtttttcaacaactcataaataaatactaaatactgaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MRRSLAPSQLAKRKQGSSSEDEEWCEDAVPKRKRLSSNKDIRENWISPFRKPLAQVTNRPTCLDSKQHEAFIRSILSKPFKIPIPNYQGGLGLRALGIKKAGIRRALHDPFEEGALVLYEPPQLSAHDLLKVDKEKVPVHVVVDPVLGKVLRPHQREGVKFLWECVTGRRISGSHGSIMADEMGLGKTLQCITLIWTLLRQSPDAKPEIEKAVVVCPSSLVKNWYNEVSKWLGGRIQPLAIDGGSKEEIDKKLSGFMNQHGMRVPSAILIISYETFRLHAEVLHRGSVGLVICDEGHRLKNSENQTYQALNSLNTVRRVLISGTPIQNDLLEYFSLVHFVNAGILGTAQEFKKRFEIPILKGRDADASAADRQKGEEKLKELIGVVNRCLIRRTSDILSKYLPVKIEQVVCCRLTPLQSELYKLFLKQAKPAEDLNEGKISVSSLSSITSLKKLCNHPSLIYEKCVEEEEGFQGALNLFPSGYSTKSVEPQLSGKMLVLDYILAVTRSTSSDKVVLVSNYTQTLDLFEKLCRTRRYLYVRLDGTMSIKKRAKIVERFNSPSSPEFIFMLSSKAGGCGLNLIGANRLVMFDPDWNPANDEQAMARVWRDGQKKTCFIYRLLSTGTIEEKIFQRQTHKKALSSCVVDEEQDVERHFSIGELKELFILNENTTSDTHDKFKCRRCVNGHQVRPPPDGTDCTSDLSQWNHCADKRGLQDPVLVSAWDAAITFTFHHQSHEEQRGVL
Donor tissue: gastrula