ORFeome > rela – XORFeome 2.0

rela – XORFeome 2.0

General Information

Species: Xenopus tropicalis v-rel reticuloendotheliosis viral oncogene homolog A, mRNA (cDNA clone MGC:69459 IMAGE:5336006), complete cds
Gene Symbol: rela
Gene ID: 407869
ORF gb_acc: MG133370
ORF ID: 10875

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC067968

Library Location

Plate ID: GDExt11008
Well Location: C07

EST Sequences

Clone: MGC:69459 IMAGE:5336006
Trimmed Sequence: ATGGAGGGATTTCTTCCTTCCCTATGGACAGACATGGTTTCAAGCACAGTCATGCCTTCCTCCCACCCACATGTGGAAATTATAGAACAGCCAAAACAGCGAGGGATGCGATTTCGTTACAAGTGTGAAGGCCGCTCTGCTGGAAGCATTCCAGGTGAACGAAGCACTGACACAACAAAAACTCATCCCACTATTAAGATAAACCATTACCAGGGCTCAGCGCGTATTCGAATATCCCTAGTTACTAAGGATTCTCCACACAAACCTCACCCTCATGAGTTGGTAGGAAAGGACTGTAAGGATGGATATTATGAAGCTGAACTTTCCCCAGATCGTAGTATTCACAGCTTCCAGAACCTTGGCATTCAGTGTGTGAAAAAGAGAGAGGTGGAGGATGCCATCGCCCATCGTATTCGGACAAATAATAACCCTTTTAATGTGCCTCCTGAGGAGCTGAAGAGTGATTACGACCTCAACACTGTTTGCCTGTGCTTCCAAGTCTTCATTCCTGATCGAGCTGCTGGTCAGGTGGTTCCTTTACCATTTGTGGTATCCCAGCCCATCTATGACAACAGAGCCCCTAATACTGCTGAACTGAAGATATGCCGAGTGAACAGAAATTCTGGGAGTTGCATGGGAGGAGATGAGATCTTCTTACTTTGTGATAAAGTACAAAAAGATATCGAGGTGCTATTCGTTTTGGGCAACTGGGAAGCTCGAGGCATATTTTCACAAGCAGATGTTCACCGCCAGGTAGCCATTGTCTTCAGAACACCTGCTTTCCATGACACAAAAATACGTCAGTCTGTCAAAGTGCAAATGCAGCTGAGGCGGCCATCAGACAAGGAAGTCAGTGAGCCTATGGAGTTTCAGTATCTTCCAGATGAAGTTGACCCCCACCATATTGATGAAAAACGGAAAAGGACCCTTGACAGTTTCAAGCATTATGTGAAGAATCCTTTTGCAGGAGGAGAGACACGAACCCCACGCAGAATTGCTGTGCCAAATCGTATAGTGCCAACAAAGTCAGAGCCTATAACAGCATCCATTAGACCCAGCCCTTCAGTTCCAAATCCAATGGTGCCTTCTCTTTCATTTTCCATGCCAGTATTGAAGGTTGACAGTGTGACTTCAGCTTCGACTCGTCTATCCACCGTTAACATCAGCGACTTCAGCAATTTAGGATTTTCATCACAGCCTCCCCCTCAGTCTGATCCTGACCGCATAGAATCCTTTTTAAACTACCCCTCATTCTCAGGCGATGCAAATCTGGATTTAGTAGAAATGTTGCCAAATGACACAGAGAGCCGCTGTACCAGTTTGAGTTCTATTGACAATAGTGATTTTAGCCAGCTTCTTAGTGAGTCACAAACATCTGGGACACTCTCAGCAGGTTTACAAGAGCCTGGGACTAGTCAAGGTACACTCATGTCCTATCCCGATTCCATCGCTCGGCTTATGAGCAACCGGCCCATTGAAGATGATGGTGAAGAAAGAATTGACAGTGTCCTAATGAATGGGGTTTTTGATATGCAGCAGGGAGTAGAGTCTATAACCTCCTTATTAGACCTTGACCTCTCTTCTTTCATGAACATTAAATAA
Full Trace Sequence: ctagcaatgtgtagcaatgtgtagaaggggcggatatctgttagggaaggaagaagaagagggatagtgaaacagtggagtggagaagtaaagagtactggtggcgaatatatcttatacatttctggaactgcaagggcagctagcccctgtaaaaggccagcattggacatggagggatttcttccttccctatggacagacatggtttcaagcacagtcatgccttcctcccacccacatgtggaaattatagaacagccaaaacagcgagggatgcgatttcgttacaagtgtgaaggccgctctgctggaagcattccaggtgaacgaagcactgacacaacaaaaactcatcccactattaagataaaccattaccagggctcagcgcgtattcgaatatccctagttactaaggattctccacacaaacctcaccctcatgagttggtaggaaaggactgtaaggatggatattatgaagctgaactttccccagatcgtagtattcacagcttccagaaccttggcattcagtgtgtgaaaaagagagaggtggaggatgccatcgcccatcgtattcggacaaataataacccttttaatgtgcctcctgaggagctgaagagtgattacgacctcaacactgtttgcctgtgcttccaagtcttcattcctgatcgagctgctggtcaggtggttcctttaccatttgtggtatcccagcccatctatgacaacagagcccctaatactgctgaactgaagatatgccgagtgaacagaaattctgggagttgcatgggaggagatgagatcttcttactttgtgataaagtacaaaaagatatcgaggtgctattcgttttgggcaactgggaagctcgaggcatattttcacaagcagatgttcaccgccaggtagccattgtcttcagaacacctgctttccatgacacaaaaatacgtcagtctgtcaaagtgcaaatgcagctgaggcggccatcagacaaggaagtcagtgagcctatggagtttcagtatcttccagatgaagttgacccccaccatattgatgaaaaacggaaaaggacccttgacagtttcaagcattatgtgaagaatccttttgcaggaggagagacacgaaccccacgcagaattgctgtgccaaatcgtatagtgccaacaaagtcagagcctataacagcatccattagacccagcccttcagttccaaatccaatggtgccttctctttcattttccatgccagtattgaaggttgacagtgtgacttcagcttcgactcgtctatccaccgttaacatcagcgacttcagcaatttaggattttcatcacagcctccccctcagtctgatcctgaccgcatagaatcctttttaaactacccctcattctcaggcgatgcaaatctggatttagtagaaatgttgccaaatgacacagagagccgctgtaccagtttgagttctattgacaatagtgattttagccagcttcttagtgagtcacaaacatctgggacactctcagcaggtttacaagagcctgggactagtcaaggtacactcatgtcctatcccgattccatcgctcggcttatgagcaaccggcccattgaagatgatggtgaagaaagaattgacagtgtcctaatgaatggggtttttgatatgcagcagggagtagagtctataacctccttattagaccttgacctctcttctttcatgaacattaaataaattgctttattaatgtgagcaataagactaagcatgagacctgcctaaaataatttggatcctgtatatttgttcagatgcagtaggactccagaaaatgttctaatataacagactgtgctggccctgtcaggctgacattgactttttggttttggaagaatatggaggaacagtacaggtggtgtaatcctgtatttgccctcttaacagacttctgtagatacttttatcaaatattttaaagttatttttgacctctgctactatttatgcagagtaaaaaaggattgtcttatgagtaccgctcatcagtcatttataagcaagtttggttgtatattctgcttttcatgggtgttcaatataatccttctcattgcctaaaaaaaaaaaaaaaaaa
Translation: MEGFLPSLWTDMVSSTVMPSSHPHVEIIEQPKQRGMRFRYKCEGRSAGSIPGERSTDTTKTHPTIKINHYQGSARIRISLVTKDSPHKPHPHELVGKDCKDGYYEAELSPDRSIHSFQNLGIQCVKKREVEDAIAHRIRTNNNPFNVPPEELKSDYDLNTVCLCFQVFIPDRAAGQVVPLPFVVSQPIYDNRAPNTAELKICRVNRNSGSCMGGDEIFLLCDKVQKDIEVLFVLGNWEARGIFSQADVHRQVAIVFRTPAFHDTKIRQSVKVQMQLRRPSDKEVSEPMEFQYLPDEVDPHHIDEKRKRTLDSFKHYVKNPFAGGETRTPRRIAVPNRIVPTKSEPITASIRPSPSVPNPMVPSLSFSMPVLKVDSVTSASTRLSTVNISDFSNLGFSSQPPPQSDPDRIESFLNYPSFSGDANLDLVEMLPNDTESRCTSLSSIDNSDFSQLLSESQTSGTLSAGLQEPGTSQGTLMSYPDSIARLMSNRPIEDDGEERIDSVLMNGVFDMQQGVESITSLLDLDLSSFMNIK
Donor tissue: tailbud