ORFeome > rhebl1 – XORFeome 2.0

rhebl1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis Ras homolog enriched in brain like 1, mRNA (cDNA clone MGC:75978 IMAGE:5384305), complete cds
Gene Symbol: rhebl1
Gene ID: 394534
ORF gb_acc: MG133489
ORF ID: 11012

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC061397

Library Location

Plate ID: GDExt11009
Well Location: E12

EST Sequences

Clone: MGC:75978 IMAGE:5384305
Trimmed Sequence: ATGGCGCCTGTCAAACACCGCAAGATTGTGATGTTGGGGTACCCTTCAGTAGGCAAATCTTCCCTTGCACTTCAGTTTATTAAAGGAGATTTTCCTAAGGACTATGAGCCTACCATTGAAAACACTTGGAGCAAGACCTTTGTTATGGGGAGTGATGAGTTTGAGTTGGATGTGGTGGACACAGCAGGGCAGGACGAATACTCTTTGTTGCCTCAGTCATTTATTTTTGGGATCCATGGATACATTGTAGTATACTCAGTGGCATGCTCCAGAAGCTTTCAGATAGCACGTGCCATTCATAGCATTCTTGTGGACAGGAGAGGGAAGTGCCTCATGCCTATAGTCCTTGTTGGGAATAAGAATGATCTGCCAACTCACTGCCGTGAAGTGAAACCAGAAGATGGGAAAAAACTAGCAGAGTCTTGGGGAGCTGCATTCCTGGAAGTTTCAGCAAAAGACCCTGAGAGGAGTAAGCTGATCTTTACTAAAATGATCGAGGAAATCGACCGCGTTGAGCGATCCTTTGGTGAAGAGAAAAAATGCTGTGTCATGTGA
Full Trace Sequence: ccaaggggtcgcagagtgcaggcatttgttttgggatttttggtttccatagggtggaagtccgtatttcggattttgttttgttcttaatcgtcatggcgcctgtcaaacaccgcaagattgtgatgttggggtacccttcagtaggcaaatcttcccttgcacttcagtttattaaaggagattttcctaaggactatgagcctaccattgaaaacacttggagcaagacctttgttatggggagtgatgagtttgagttggatgtggtggacacagcagggcaggacgaatactctttgttgcctcagtcatttatttttgggatccatggatacattgtagtatactcagtggcatgctccagaagctttcagatagcacgtgccattcatagcattcttgtggacaggagagggaagtgcctcatgcctatagtccttgttgggaataagaatgatctgccaactcactgccgtgaagtgaaaccagaagatgggaaaaaactagcagagtcttggggagctgcattcctggaagtttcagcaaaagaccctgagaggagtaagctgatctttactaaaatgatcgaggaaatcgaccgcgttgagcgatcctttggtgaagagaaaaaatgctgtgtcatgtgaaattaattttatcctcctgcaccatctgattggaggagcagcagaactaagtgtgaagcctggtggttgtgacatccctctgcccagtgatgttacagcagcagacctatgcaccaatcaatgcaatcctttttggcacggcagaagattacatgatgtttcctttgctgggtcagatgacaccttccctacgttttgatactttcagtatggaatatgatttatcaagtcttgaactgattaatctcactttttggttttcaaatctgtagctatgtcatggacgagcacagactgcaacagcagttgaatttacaatatcgagccctttttatggatgcatataatgcagtttgcacaaactttgcagcagtgctgttgctatgtacatatatattgattttttggactgtgtaacctgttacagggcctatttatgtttatttgtaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MAPVKHRKIVMLGYPSVGKSSLALQFIKGDFPKDYEPTIENTWSKTFVMGSDEFELDVVDTAGQDEYSLLPQSFIFGIHGYIVVYSVACSRSFQIARAIHSILVDRRGKCLMPIVLVGNKNDLPTHCREVKPEDGKKLAESWGAAFLEVSAKDPERSKLIFTKMIEEIDRVERSFGEEKKCCVM
Donor tissue: neurula