ORFeome > rnaseh2a – XORFeome 2.0

rnaseh2a – XORFeome 2.0

General Information

Species: Xenopus tropicalis ribonuclease H2, large subunit, mRNA (cDNA clone MGC:76169 IMAGE:5335526), complete cds
Gene Symbol: rnaseh2a
Gene ID: 394751
ORF gb_acc: MG132707
ORF ID: 9999

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC061614

Library Location

Plate ID: GDExt11001
Well Location: A03

EST Sequences

Clone: MGC:76169 IMAGE:5335526
Trimmed Sequence: ATGGAGCTTGAAGAATTCGAGCGCGATAATTCCCAGAATCGCCTGCTGAGCTCTCCGGTACCGGAGATATGTCGGACGGAGGACTGCTGCCTTGGGATAGATGAGGCCGGCCGGGGACCCGTACTGGGTCCTATGGTTTATGGAATCTGTTACTGCCCTGTGGCCCGGAAGAAGGATCTTCAGGATTTGAAGGTGGCAGACTCCAAGACACTGAGTGAAGCTGAGAGGGAACGGCTGTTTGAGAAATTAAACAGTACTTCTGATTACATCGGCTGGGCCTTGCATATACTCTCACCTAACATCATTTCAACCAGCATGCAGCAGAGGGCAAAATACAACCTGAATGCTTTATCCCACGACACGGCTATCGGCCTAATTCAGTTTGCCCTGGATGCAGGAGTGCAGCTGAAAGAGGTTTTTCTGGACACTGTGGGCCCTGCAGAGAAGTACCAAGACAAGCTGAAGAAGATATTCCCAGAGCTGGACGTTACTGTTAGGCCCAAAGCTGATTCATTGTTCCCTGTAGTCAGTGCTGCGAGTATCTGTGCAAAGGTGGCAAGGGACCGGGTGGTGAAAGAATGGAAGTTTGTAGAAGATCTAGGCGATCCTGATGCAGAATATGGCTCTGGATATCCAAATGACCCCAAGACAAAAGACTGGCTCTCTCGGCATCTCGATCCCGTTTTTGGATACCCGCAGTTTGTAAGGTTCAGCTGGAGCACAACACAGACTATCCTGGGTAACAAGGCTGCCCCGGTTTCTTGGGGTGACGAGGATGACGACTCGGGTGGCAAATCCTCTACTCCTTCTGTCCTGTCGTTCTTCTCCGCCCCAAAGGATGCCTCCCAGCCCCAGAGCCACCGATTTTTCCAGGAACGGAACCTTAAGCCTCTGTTGGAGTTTTAG
Full Trace Sequence: cagcatggagcttgaagaattcgagcgcgataattcccagaatcgcctgctgagctctccggtaccggagatatgtcggacggaggactgctgccttgggatagatgaggccggccggggacccgtactgggtcctatggtttatggaatctgttactgccctgtggcccggaagaaggatcttcaggatttgaaggtggcagactccaagacactgagtgaagctgagagggaacggctgtttgagaaattaaacagtacttctgattacatcggctgggccttgcatatactctcacctaacatcatttcaaccagcatgcagcagagggcaaaatacaacctgaatgctttatcccacgacacggctatcggcctaattcagtttgccctggatgcaggagtgcagctgaaagaggtttttctggacactgtgggccctgcagagaagtaccaagacaagctgaagaagatattcccagagctggacgttactgttaggcccaaagctgattcattgttccctgtagtcagtgctgcgagtatctgtgcaaaggtggcaagggaccgggtggtgaaagaatggaagtttgtagaagatctaggcgatcctgatgcagaatatggctctggatatccaaatgaccccaagacaaaagactggctctctcggcatctcgatcccgtttttggatacccgcagtttgtaaggttcagctggagcacaacacagactatcctgggtaacaaggctgccccggtttcttggggtgacgaggatgacgactcgggtggcaaatcctctactccttctgtcctgtcgttcttctccgccccaaaggatgcctcccagccccagagccaccgatttttccaggaacggaaccttaagcctctgttggagttttaggagcatcggcagtaagggccacgtgctgcagttaccttcgacctctcttactgggggtaataccagaagctatggaactcctgcagttgaactagaactctctcacagtcatctagattggatgtccctactctaaggttcagtcgggccgggttgattcacagagtagcttttccagtgctttatatgtgaagccatagagctgcacacttgtgttctgtggccccaatgtatgtctattggcaatgtcatggcaattgggaattgcattgacactatagtgagccattaaagttaactgagcagaaaaaaaaaaaaaaa
Translation: MELEEFERDNSQNRLLSSPVPEICRTEDCCLGIDEAGRGPVLGPMVYGICYCPVARKKDLQDLKVADSKTLSEAERERLFEKLNSTSDYIGWALHILSPNIISTSMQQRAKYNLNALSHDTAIGLIQFALDAGVQLKEVFLDTVGPAEKYQDKLKKIFPELDVTVRPKADSLFPVVSAASICAKVARDRVVKEWKFVEDLGDPDAEYGSGYPNDPKTKDWLSRHLDPVFGYPQFVRFSWSTTQTILGNKAAPVSWGDEDDDSGGKSSTPSVLSFFSAPKDASQPQSHRFFQERNLKPLLEF
Donor tissue: tailbud