ORFeome > rnf121 – XORFeome 2.0

rnf121 – XORFeome 2.0

General Information

Species: Xenopus tropicalis ring finger protein 121, mRNA (cDNA clone MGC:75651 IMAGE:5379638), complete cds
Gene Symbol: rnf121
Gene ID: 394908
ORF gb_acc: MG132847
ORF ID: 10199

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC064173

Library Location

Plate ID: GDExt11003
Well Location: B04

EST Sequences

Clone: MGC:75651 IMAGE:5379638
Trimmed Sequence: ATGGCGGCAGTGCTGGAGGTGGAAATAGGGGGAGAGGCTGTGAGAGAAGCCGCGGGGGAAGAGGTGGATTTGTCTGAACTGGCGCCGGAGGAACGATGGAGGGTGGAGCACGCGCGGATGCACGCCAAGCACCGGGGCCACGAGGCCATGCACGCGGAGATGGTCCTTATCCTTATTGCCACCCTGGTGGTGGCACAGCTGCTGCTTGTACAGTGGAAGCAAAGGCACCAGCGCTCCTATAATATGGTCACGCTCTTCCAGATGTGGATCGTCCCTGTGTATTTCACAGTAAAGCTGCACTGGTGGCGGTTCCTGGGCATATGGTTTCTCTTCTCCATAGTTACAGCCTTTGTTACGTACAAAGCAACAAGGAAACCCTTAGTGCAGACCACCCCCAGGCTGGTGTATAAATGGTTCCTGCTGCTGTACAAGATGAGCTACGCCACGGGGATTGTGGGATACATCGCCGTCATGTTCACTCTGTTCGGCCTAAACTTACTGTTCAGGATAAAACCAGAGGATGCCATGGACTTTGGGATATCGCTCCTGTTCTACGGCCTTTATTATGGGGTGCTTGGCCGTGACTTTGCAGAGATGTGTGCAGACTACATGGCGTCCACCATAGGGTTCTACAGCGCCTCGGGGATGCCCACCAAGCACCTGTCAGACAGCGTCTGCGCCGTGTGCGGCCAACAGATCTTCGTAGACGTCAATGAGGAGGGGATCATCGAGAACACGTACAGGCTGTCCTGCAACCATGTCTTCCATGAGTTCTGTATCCGCGGCTGGTGCATCGTGGGAAAGAAGCAGACCTGTCCGTATTGCAAGGAGAAGGTGGACCTCAAGCGGATGTTCAGTAACCCATGGGAGAGACCACACGTCATGTACGGGCAACTGCTGGACTGGCTACGGTACCTTGTTGCCTGGCAACCTGTAATCATTGGACTGGTACAAGGCATCAATTACTGCCTGGGACTGGAATAA
Full Trace Sequence: gtggaaaggtgtagggggagccatttaggttgtaccggtaccgacctgcgggatctcttggggcaatgggggcttgttccagggagaggaactagttgccggcagttcttgtcctgtgattggtcagatgctcacggaggccgctggcatagtacagaatggcggcagtgctggaggtggaaatagggggagaggctgtgagagaagccgcgggggaagaggtggatttgtctgaactggcgccggaggaacgatggagggtggagcacgcgcggatgcacgccaagcaccggggccacgaggccatgcacgcggagatggtccttatccttattgccaccctggtggtggcacagctgctgcttgtacagtggaagcaaaggcaccagcgctcctataatatggtcacgctcttccagatgtggatcgtccctgtgtatttcacagtaaagctgcactggtggcggttcctgggcatatggtttctcttctccatagttacagcctttgttacgtacaaagcaacaaggaaacccttagtgcagaccacccccaggctggtgtataaatggttcctgctgctgtacaagatgagctacgccacggggattgtgggatacatcgccgtcatgttcactctgttcggcctaaacttactgttcaggataaaaccagaggatgccatggactttgggatatcgctcctgttctacggcctttattatggggtgcttggccgtgactttgcagagatgtgtgcagactacatggcgtccaccatagggttctacagcgcctcggggatgcccaccaagcacctgtcagacagcgtctgcgccgtgtgcggccaacagatcttcgtagacgtcaatgaggaggggatcatcgagaacacgtacaggctgtcctgcaaccatgtcttccatgagttctgtatccgcggctggtgcatcgtgggaaagaagcagacctgtccgtattgcaaggagaaggtggacctcaagcggatgttcagtaacccatgggagagaccacacgtcatgtacgggcaactgctggactggctacggtaccttgttgcctggcaacctgtaatcattggactggtacaaggcatcaattactgcctgggactggaataaacccctccccctaatccctttcttctcccctccccccgccgtgtgaaaatccatgtttgcctgcagtaccggagcccaacgcaagggggcgccggcgaggcttctcccacttctcaggatcggacccggcggcccccaattctcatgggagcagcagtgtcagcgggacggggcccctgtcgtattatttatggcaacatttttctttggcggtttcgcccctaagggccccgtcactttattgttcattttaatccgtttatcccccactcggtctcccagggcagcggtccgtttagctttaggtcacttcctgtgtgtgctattgccccctgcagtgttaggagcaccccagcatcatcgccctgtagggacggcgccacctactggcctggaggagcactgggaggcctaaggcaccattgttttcaatggaggaggaggaggagcctggcatctctaacatggcggcacgtggagcgcatgttccggagactccagttaaccccgcgtatccgcccctctcatgactccagcgccgccattgtaggaccaaaccgggtgtttccttccctaaaaccccacaatgcaaatctgacttttaggaaaatgttttaaaggaatgtcaatgagaaaaaaaaaaaaaaaa
Translation: MAAVLEVEIGGEAVREAAGEEVDLSELAPEERWRVEHARMHAKHRGHEAMHAEMVLILIATLVVAQLLLVQWKQRHQRSYNMVTLFQMWIVPVYFTVKLHWWRFLGIWFLFSIVTAFVTYKATRKPLVQTTPRLVYKWFLLLYKMSYATGIVGYIAVMFTLFGLNLLFRIKPEDAMDFGISLLFYGLYYGVLGRDFAEMCADYMASTIGFYSASGMPTKHLSDSVCAVCGQQIFVDVNEEGIIENTYRLSCNHVFHEFCIRGWCIVGKKQTCPYCKEKVDLKRMFSNPWERPHVMYGQLLDWLRYLVAWQPVIIGLVQGINYCLGLE
Donor tissue: tailbud