ORFeome > rnf126 – XORFeome 2.0

rnf126 – XORFeome 2.0

General Information

Species: Xenopus tropicalis ring finger protein 126, mRNA (cDNA clone MGC:89337 IMAGE:6987713), complete cds
Gene Symbol: rnf126
Gene ID: 448402
ORF gb_acc: MG133782
ORF ID: 11354

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC075492

Library Location

Plate ID: GDExt11013
Well Location: E04

EST Sequences

Clone: MGC:89337 IMAGE:6987713
Trimmed Sequence: ATGGCGGAGGCTCTACCGGAGGCCGGGAGGTACTTCTGTCACAGCTGTACGGCCGAGATCATCCCGCGGTTACCGGAATATACCTGCCCTAGGTGTGATTCAGGATTCATAGAGGAGCTCCCTGAAACAAGAAATTCAGAAAACAATAGCAGCAACAATTCTGGAACAGATCAAAACAGACCTTCGTTTGAGAACCTAGAGTCTGCTCAGTTCACGCTTCCTTCTGGGTATGGCCAGGTCACATTTGGAATCTTTAATGAGGGCCTGGACTTTCCCATCTTTGGCACTAGTGGTCCAGTTGAAGAGCCACGTGATGGAGAGAGCAGGAGGGAGCATCAGTCACGGCAGAGATATGGTGCTAGACAGCCCCGTGCTAGGTTAAGCACAAGACGAGCTGCAGGAAGGAACGAGGGAGTACCTACACTAGAGGGGATCATTCAGCAGTTGGTGAATGGGATTATCGCACCTACAGCAATGTCAAACCTAGGGGTGGGACCATGGGGTGTCCTGCATTCCAACCCCATGGATTATGCATGGGGTGCAAATGGCCTAGATACAATAATCACACAATTACTTAATCAGTTTGAAAACACAGGCCCTCCCCCTGCGGACACTGAAAAAATACAAGCCCTTCCTACCATCCAGATAACAGAAGAGCATGTGGGTTCTGGTCTGGAGTGTCCCGTGTGTAAAGAGGATTATACTGTTGGTGAAAGTGTGCGGCAACTTCCTTGCAATCATTTATTTCACAATGACTGCATCATCCCTTGGTTAGAACAGCATGACACATGTCCTGTTTGCCGAAAAAGTCTTAGTGGCCAGAACACAGCAACGAATCCCCCTGGACTGACAGAAATGACTTTCTCCTCATCTTCAACCTCTTCTTCCTCCTCCACCTCCCCTACTGATGAAAATAATGCTGCCAACAATTCCTGA
Full Trace Sequence: ccatgacctgtggtttgcaccctgcgctaaccaatgctgcgcgatttgactcctttctctttccttcgactggtcgcagcgtgctgacatcacagacgtcatctccagggcagcggaaaatggcggaggctctaccggaggccgggaggtacttctgtcacagctgtacggccgagatcatcccgcggttaccggaatatacctgccctaggtgtgattcaggattcatagaggagctccctgaaacaagaaattcagaaaacaatagcagcaacaattctggaacagatcaaaacagaccttcgtttgagaacctagagtctgctcagttcacgcttccttctgggtatggccaggtcacatttggaatctttaatgagggcctggactttcccatctttggcactagtggtccagttgaagagccacgtgatggagagagcaggagggagcatcagtcacggcagagatatggtgctagacagccccgtgctaggttaagcacaagacgagctgcaggaaggaacgagggagtacctacactagaggggatcattcagcagttggtgaatgggattatcgcacctacagcaatgtcaaacctaggggtgggaccatggggtgtcctgcattccaaccccatggattatgcatggggtgcaaatggcctagatacaataatcacacaattacttaatcagtttgaaaacacaggccctccccctgcggacactgaaaaaatacaagcccttcctaccatccagataacagaagagcatgtgggttctggtctggagtgtcccgtgtgtaaagaggattatactgttggtgaaagtgtgcggcaacttccttgcaatcatttatttcacaatgactgcatcatcccttggttagaacagcatgacacatgtcctgtttgccgaaaaagtcttagtggccagaacacagcaacgaatccccctggactgacagaaatgactttctcctcatcttcaacctcttcttcctcctccacctcccctactgatgaaaataatgctgccaacaattcctgagccccggtgcggaactaatggatcatctgcatactgctcccttattatgtggccctctcctgtactgttctcccacctttacagcagatagaagctttacattcggggcctcactccaggatgcttaattggacctaggggatgagtctcctcctgctggtgggaggcagatggaaactaaacattatttttttttatcccctctaggctttgcaaacaatataggtggaaagagaccgaataggtgcgagctgagccttttttttttctttttgaaagggggagggtatttccccacttttaaaaaacaaaacaaaaaaagcagaaaacagtttatgtgaggtgactcatttattatttttattttttttttaatgttttgacatttttaatctttaaattaaaagtttatggttgagtctgctcctggagtgagcagctactgcacaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MAEALPEAGRYFCHSCTAEIIPRLPEYTCPRCDSGFIEELPETRNSENNSSNNSGTDQNRPSFENLESAQFTLPSGYGQVTFGIFNEGLDFPIFGTSGPVEEPRDGESRREHQSRQRYGARQPRARLSTRRAAGRNEGVPTLEGIIQQLVNGIIAPTAMSNLGVGPWGVLHSNPMDYAWGANGLDTIITQLLNQFENTGPPPADTEKIQALPTIQITEEHVGSGLECPVCKEDYTVGESVRQLPCNHLFHNDCIIPWLEQHDTCPVCRKSLSGQNTATNPPGLTEMTFSSSSTSSSSSTSPTDENNAANNS
Donor tissue: gastrula