ORFeome > rnf146 – XORFeome 2.0

rnf146 – XORFeome 2.0

General Information

Species: Xenopus tropicalis ring finger protein 146, mRNA (cDNA clone MGC:79638 IMAGE:6980072), complete cds
Gene Symbol: rnf146
Gene ID: 493422
ORF gb_acc: MG133598
ORF ID: 11135

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC080946

Library Location

Plate ID: GDExt11012
Well Location: F01

EST Sequences

Clone: MGC:79638 IMAGE:6980072
Trimmed Sequence: ATGGCTGGTTGTGGTGAAGTTAGCCACTCTGCTAACATGCTGCCCACTAATAAGAAACTGGTTGAGCCTTGTCCCAACAGTGCTCCTTCATTGTCTGTTCCTGAATGTGCTATATGCCTGCAGACCTGTGTGCATCCAGTTAGTCTACCTTGTAAACACATATTCTGCTACTTGTGTGTGAAGGGGGCTTCTTGGCTTGGAAGGCGTTGTGCTTTGTGCAGACAAGAGATTCCTGAGGACTTTCTTGATAAGCCTACATTACTGTCACCTGAGGAACTGAAATCTGCAAGTAGGGGAAATGGAGAATATGCATGGTATTATGAGGGAAGAAATGGTTGGTGGCAGTATGATGAGCGGACAAGCAGAGAGCTTGAAGATGCCTTCACAAAAGGCAAAAAGAGCACAGAGATGTTGATAGCTGGCTTCCTCTATGTAGCAGACTTGGAGAACATGGTTCAATACAGGCGTAATGAGCATGGACGGCGTAGAAAAATCAAGAGAGATATTGTAGATATACCAAAAAAAGGAGTTGCTGGGCTAAGGCTTGAATGTGATGCAGCAAATGTAAATCTAGCGCGAGAGAGCTCAGCAGATGGTGCGGACAACATGGCAGCACTTGGAGCTTCTTCAAGTCAACCTACACCTGTGTTACCAACAAGGCTGCACACATCCCTCAGTACAACTGCAAGTCATGCCCTTTCACATTCTGATGTTACTTCTTCATTGGAGAACTCCTTTGCTCAGCTTCAGATTGGCGATCCTGTGATAGGCAGGAATAATATAGGTGAAGGTGAAGAAGGACAGCCTCTAATTAACGCTAGAATGCCAGCCCCCAGTGCTTTGCTGGAAGAATCAGAGCCAAGTGACAGTAATGACCATGGAAGTCCTACATTACAACATAATTCACTTCTTGTGCCACAAAGTAATAGGCTCCCATTTGGTAATCCCTGA
Full Trace Sequence: attaaacggcaatctggttctgcgggctgtgttaaaaatatcgagagcgtcccgcgagaagcgggactgttgggcggatggctggttgtggtgaagttagccactctgctaacatgctgcccactaataagaaactggttgagccttgtcccaacagtgctccttcattgtctgttcctgaatgtgctatatgcctgcagacctgtgtgcatccagttagtctaccttgtaaacacatattctgctacttgtgtgtgaagggggcttcttggcttggaaggcgttgtgctttgtgcagacaagagattcctgaggactttcttgataagcctacattactgtcacctgaggaactgaaatctgcaagtaggggaaatggagaatatgcatggtattatgagggaagaaatggttggtggcagtatgatgagcggacaagcagagagcttgaagatgccttcacaaaaggcaaaaagagcacagagatgttgatagctggcttcctctatgtagcagacttggagaacatggttcaatacaggcgtaatgagcatggacggcgtagaaaaatcaagagagatattgtagatataccaaaaaaaggagttgctgggctaaggcttgaatgtgatgcagcaaatgtaaatctagcgcgagagagctcagcagatggtgcggacaacatggcagcacttggagcttcttcaagtcaacctacacctgtgttaccaacaaggctgcacacatccctcagtacaactgcaagtcatgccctttcacattctgatgttacttcttcattggagaactcctttgctcagcttcagattggcgatcctgtgataggcaggaataatataggtgaaggtgaagaaggacagcctctaattaacgctagaatgccagcccccagtgctttgctggaagaatcagagccaagtgacagtaatgaccatggaagtcctacattacaacataattcacttcttgtgccacaaagtaataggctcccatttggtaatccctgattgtaccccacctgcataggcacaaagtaccagtgtaaggtctaaaagacctgatggacagtgcacagtcacagaagtctaaagcagtcagccagagaaagaagagcaatgtcatccttgttatttccttagtatgttttagacttgagctcagacttagaatatttgtttaaaaaaattatttttaccattaacatgaagtatcttgctctttggccgaaagacctgtttatatataattataattaatggggaaaaagaggctgtggcctaatagctgtttgctaaatgggaatggcatacattgacattttactttgtggtgctaaaccaaaaggtaccctatgtgtaatacataaaaatgttttgggggtctcctgagaacagtgtatgacttgggatataaaaaatactatagcctgtatgtaggttagaaattgtgtttaacatatagtaagtgtaacatttattgtgttcactcagcattccttcactgtgcatttaacatgttgcttgccttgactgagttgtcctcttgacatctattttccttagatgtgaagaggacaactgttttgtatacctgtaatgcagttttcccccataaatgcagatgtgcacacttggaatgttttatgaacacaaaaggctgtaccccgatcatttaaaatttcagggagagtaagataaaatttacttacaaataaggcaatttaccaataaagttgctacgttgtgtgtgtaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MAGCGEVSHSANMLPTNKKLVEPCPNSAPSLSVPECAICLQTCVHPVSLPCKHIFCYLCVKGASWLGRRCALCRQEIPEDFLDKPTLLSPEELKSASRGNGEYAWYYEGRNGWWQYDERTSRELEDAFTKGKKSTEMLIAGFLYVADLENMVQYRRNEHGRRRKIKRDIVDIPKKGVAGLRLECDAANVNLARESSADGADNMAALGASSSQPTPVLPTRLHTSLSTTASHALSHSDVTSSLENSFAQLQIGDPVIGRNNIGEGEEGQPLINARMPAPSALLEESEPSDSNDHGSPTLQHNSLLVPQSNRLPFGNP
Donor tissue: tailbud