ORFeome > rps6 – XORFeome 2.0

rps6 – XORFeome 2.0

General Information

Species: Xenopus tropicalis ribosomal protein S6, mRNA (cDNA clone MGC:76307 IMAGE:5379757), complete cds
Gene Symbol: rps6
Gene ID: 394757
ORF gb_acc: MG132831
ORF ID: 10181

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC061628

Library Location

Plate ID: GDExt11002
Well Location: F10

EST Sequences

Clone: MGC:76307 IMAGE:5379757
Trimmed Sequence: ATGAAGCTTAACATCTCCTTCCCAGCCACTGGCTGCCAAAAGCTCATCGAAGTGGAGGATGAGCGCAAGCTGCGTACCTTCTATGAGAAGCGCATGGCTACAGAGGTTGCTGCAGATCCCTTGGGTGATGAGTGGAAGGGATATGTCGTTCGCATCAGCGGTGGAAATGATAAGCAAGGCTTTCCCATGAAACAGGGAGTGCTAACTCATGGCCGTGTTCGTCTTCTGTTGAGCAAGGGTCATTCCTGTTATCGCCCCAGGAGGACTGGTGAACGCAAGCGCAAGTCTGTTCGTGGGTGTATTGTGGATGCTAACCTGAGTGTCCTGAACTTGGTTATTGTTAGGAAAGGCGAGAAGGATATTCCTGGACTTACAGACAACACTGTTCCTCGTCGCCTGGGTCCCAAAAGAGCCAGCAGAATCCGCAAACTGTTCAACTTGTCAAAAGAAGATGATGTGCGTCAATATGTAGTGAGGAAGCCTCTGGCTAAGGAGGGGAAGAAGCCCAGGACCAAGGCCCCTAAAATCCAGCGTCTAGTGACCCCGAGAGTTCTGCAGCACAAGCGCAGACGTATTGCTTTGAAGAAGCAGCGCACTCAGAAGAATAAGGAAGAGGCATCAGAGTATGCTAAACTTCTGGCTAAGAGAACAAAGGAAGCCAAGGAAAAACGCCAGGAGCAAATTGCCAAGAGGCGCAGACTGTCTTCTTTGAGAGCCTCCACATCCAAATCTGAATCGAGTCAGAAATAA
Full Trace Sequence: gggggatctaagacagactggttgttggccatgaagcttaacatctccttcccagccactggctgccaaaagctcatcgaagtggaggatgagcgcaagctgcgtaccttctatgagaagcgcatggctacagaggttgctgcagatcccttgggtgatgagtggaagggatatgtcgttcgcatcagcggtggaaatgataagcaaggctttcccatgaaacagggagtgctaactcatggccgtgttcgtcttctgttgagcaagggtcattcctgttatcgccccaggaggactggtgaacgcaagcgcaagtctgttcgtgggtgtattgtggatgctaacctgagtgtcctgaacttggttattgttaggaaaggcgagaaggatattcctggacttacagacaacactgttcctcgtcgcctgggtcccaaaagagccagcagaatccgcaaactgttcaacttgtcaaaagaagatgatgtgcgtcaatatgtagtgaggaagcctctggctaaggaggggaagaagcccaggaccaaggcccctaaaatccagcgtctagtgaccccgagagttctgcagcacaagcgcagacgtattgctttgaagaagcagcgcactcagaagaataaggaagaggcatcagagtatgctaaacttctggctaagagaacaaaggaagccaaggaaaaacgccaggagcaaattgccaagaggcgcagactgtcttctttgagagcctccacatccaaatctgaatcgagtcagaaataaaactccatcatgtaaaaataaatacattttgttgtaaacttaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MKLNISFPATGCQKLIEVEDERKLRTFYEKRMATEVAADPLGDEWKGYVVRISGGNDKQGFPMKQGVLTHGRVRLLLSKGHSCYRPRRTGERKRKSVRGCIVDANLSVLNLVIVRKGEKDIPGLTDNTVPRRLGPKRASRIRKLFNLSKEDDVRQYVVRKPLAKEGKKPRTKAPKIQRLVTPRVLQHKRRRIALKKQRTQKNKEEASEYAKLLAKRTKEAKEKRQEQIAKRRRLSSLRASTSKSESSQK
Donor tissue: tadpole