ORFeome > rraga – XORFeome 2.0

rraga – XORFeome 2.0

General Information

Species: Xenopus tropicalis Ras-related GTP binding A, mRNA (cDNA clone MGC:69533 IMAGE:5336607), complete cds
Gene Symbol: rraga
Gene ID: 448744
ORF gb_acc:
ORF ID: 10901

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC074593

Library Location

Plate ID: GDExt11008
Well Location: A09

EST Sequences

Clone: MGC:69533 IMAGE:5336607
Trimmed Sequence: ATGCCGAGTTCCGCCATGAAGAAAAAGGTTCTGTTGATGGGAAAGAGTGGGTCTGGAAAGACCAGCATGAGATCTATCATCTTCGCCAATTATATTGCTCGCGACACTCGGCGGCTGGGGGCCACAATCGATGTGGAGCACTCTCACGTGCGCTTCTTGGGCAACTTGGTCCTCAACCTGTGGGACTGTGGTGGGCAGGACACCTTTATGGAAAACTACTTCACCAGTCAGCGGGACAACATCTTCCGCAACGTGGAGGTCCTTATCTATGTGTTTGATGTGGAGAGCAGAGAGCTGGAGAAGGACATGCACTACTATCAATCCTGCCTAGAGGCTATCCTGCAGAACTCACCCGATGCCAAAGTCTTCTGCTTGGTGCACAAGATGGACCTGGTGCAGGAAGATCAGCGGGACCTTATATTTAAAGAGCGGGAGGAGGATCTCCGGCGCCTGTCCCGGCCTTTGGACTGTGCTTGCTTTAGGACTTCTATCTGGGATGAAACTCTGTACAAGGCGTGGTCCAGTATAGTCTACCAGCTCATTCCCAACGTACAGCAGCTGGAGTCCAACCTGCGGAACTTTGCTCAGATTATTGAGGCCGACGAGGTGCTGCTGTTCGAGAGAGCAACGTTTCTGGTCATTTCCCATTACCAATGCAAGGAACAGCGGGACATCCACCGATTTGAAAAGATCAGCAATATAATAAAACAATTCAAGCTAAGCTGCAGTAAACTGGCCGCCTCCTTTCAGAGCATGGAGGTGCGAAATTCCAACTTCGCCGCCTTCATTGACATCTTTACCTCTAACACCTACGTGATGGTCGTGATGTCGGACCCCTCAATCCCCTCGGCGGCGACTCTTATCAATATCCGCAACGCCAGGAAGCACTTTGAGAAGCTGGAGCGCGTCGACGGCCCCAAACACAGCCTGCTCATGCGTTGA
Full Trace Sequence: gcggaagtggctgcggagcgtcagataggcggtccggcgcggagataggtttttctctgtatgtgtgatgccgagttccgccatgaagaaaaaggttctgttgatgggaaagagtgggtctggaaagaccagcatgagatctatcatcttcgccaattatattgctcgcgacactcggcggctgggggccacaatcgatgtggagcactctcacgtgcgcttcttgggcaacttggtcctcaacctgtgggactgtggtgggcaggacacctttatggaaaactacttcaccagtcagcgggacaacatcttccgcaacgtggaggtccttatctatgtgtttgatgtggagagcagagagctggagaaggacatgcactactatcaatcctgcctagaggctatcctgcagaactcacccgatgccaaagtcttctgcttggtgcacaagatggacctggtgcaggaagatcagcgggaccttatatttaaagagcgggaggaggatctccggcgcctgtcccggcctttggactgtgcttgctttaggacttctatctgggatgaaactctgtacaaggcgtggtccagtatagtctaccagctcattcccaacgtacagcagctggagtccaacctgcggaactttgctcagattattgaggccgacgaggtgctgctgttcgagagagcaacgtttctggtcatttcccattaccaatgcaaggaacagcgggacatccaccgatttgaaaagatcagcaatataataaaacaattcaagctaagctgcagtaaactggccgcctcctttcagagcatggaggtgcgaaattccaacttcgccgccttcattgacatctttacctctaacacctacgtgatggtcgtgatgtcggacccctcaatcccctcggcggcgactcttatcaatatccgcaacgccaggaagcactttgagaagctggagcgcgtcgacggccccaaacacagcctgctcatgcgttgagccgccattgggaacagtttaattctgttggagccgagctcggtttctccacccatccttcctttgagcagtctcctggagtagccctctttgttacataaaggcttcttcaggagcagccattctccttgggatcactactcgctgcagcctcactgtgcaattcatgtactgttacacagtttatctgccgaggctgaaccttcccgctgtcagactcactggcttccctcattcattgcattatttgtgctttgctgctctgagccccttcccactgactgaactgcctcattgctagtgcacatacaaagagaggaaacgttctctcaaggttcaattccccccttagtcccccaactttaagttcattggacagttggcttgccctttagttgtggatgaattgaatcttgctgtggtttatagtgttaggttaacatccttctgttaatgagtacgaggctctacattcagtgtattgtaagctttggaataaaatatttatacctaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MPSSAMKKKVLLMGKSGSGKTSMRSIIFANYIARDTRRLGATIDVEHSHVRFLGNLVLNLWDCGGQDTFMENYFTSQRDNIFRNVEVLIYVFDVESRELEKDMHYYQSCLEAILQNSPDAKVFCLVHKMDLVQEDQRDLIFKEREEDLRRLSRPLDCACFRTSIWDETLYKAWSSIVYQLIPNVQQLESNLRNFAQIIEADEVLLFERATFLVISHYQCKEQRDIHRFEKISNIIKQFKLSCSKLAASFQSMEVRNSNFAAFIDIFTSNTYVMVVMSDPSIPSAATLINIRNARKHFEKLERVDGPKHSLLMR
Donor tissue: tailbud