ORFeome > rrp1b – XORFeome 2.0

rrp1b – XORFeome 2.0

General Information

Species: Xenopus tropicalis ribosomal RNA processing 1 homolog B, mRNA (cDNA clone MGC:97599 IMAGE:6977982), complete cds
Gene Symbol: rrp1b
Gene ID: 548677
ORF gb_acc: MG134422
ORF ID: 12118

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC091594

Library Location

Plate ID: GDExt11021
Well Location: F05

EST Sequences

Clone: MGC:97599 IMAGE:6977982
Trimmed Sequence: ATGGCTTCCCAGGATGCTGCCGTGCTGCTGGCCCAGAGACTGGCGGGGAACGATAAGAAGACTCGGGACCGGGCTCTGCGCAAACTGCGGAACTACCTGAGAGTGAGGAGCGCGTCTGACTCCGGAGGATTCACAGAGGAGGAATTTATCAAGATCTGGAAGGGGCTGTTCTACTGTATGTGGATGCAGGATAAACCATTATTGCAGGAGGCTTTGGCACAATCCATGTCCCAGCTGGTTCACACGCTGCACACACAGGAATCACAGAACCTTTTCCTGCGCACGTTTTGGCAGACGCTGAGCCGGGAATGGAACGGGATTGATCGGCTGCGGCTGGACAAGTTCTATACGTTAATGCGGATGGTGTTGCGGGAGTCAGTGGAGCTTCTGAAGAAAGCTGAATGGGAGGAGAGCTCTGTGCAGGAGTTCCTGGCGCTGCTGAATGAAGAGGTGCTGAAGGGGGCAACTCTGGGGGTGCAGCTCCATCTCATAGACATTTACCTGGAAGAGGTGGCTAAAGTAGGAGCAGCAGAGCTCACTGCGGAAATGAACCTGAAGCTGATTGAGCCCTTCTGTAAGATCGTAGCCAAAAGCAAGAATTACTCCTTCCTGCAGGCCGTTACCTCGGGGATATTCCAGACTATTCTGGAGCAGGCTCCCTTCGCTATAGAAGATTTAATGAAGGAAATTGATTCCAACCCCGAGGGCAAAGAGGGAGGTTCCGCAGGGGAGGAGTCAGGAGAGAAGTCAGAATCAGAAGACAAAGAGTCCCAAGAACAGGACAATGAGGACATTGGGCCAGTACTGCAGTTTGATTACCAGGCAGTGGCAGACAGACTCTTCGCTCTCGGAAGCAGAAAGAACTTGCCCACTCGGAACCGCAAAGCAGCGTATGCCCTGGTGAAAAAGTTCCGGGACTTGGCTGAAGGGATCTTCCCCAGCGAGGACTTCCCGGAGGAGGTTTCCACGGACGAGGATGATGATGATTACAGCAGCTGGCTGTTCCGCAAGAGGATGAAGAGGGCGCAAGAGAATGGGTCCTATGGAATAGTATCCCGGCTTTCCGACGGTAACGCAGTCAAGGAAAAAAAACGGGAGAAGCGGAAGCGAGTGGGCGTGGCTCCGGACGAGTCCAAATTAAAAAATGACCCCCCTGCAGCAAAAAGGAAACGTAAGAGGAGGAAGACGGACGAAAACAACAACACCCCGAGCCAGGAACAAGCCCCCCAACCTTCCCAAAATGGCGTGGCCCAAAGCTGCTGTACAGAAAATCACAATGAACAGAAGGGGTCGCCCCAACCTGCCCCGACCCCCTCACCAGACTGTACCCCAACCCTCTCAAAGAAACCCCCCGGGAAGAGGAGAAGGGCTGGGCTGATCCGAACCAGCCTCCGTATTCTGCCCCTGACTGGGTCCTTACTGAGGAGGAGGCAACTCCGGCTGCTCAGGAGCAAGTGCAAGATTTCCCAGCAGCCAATGGGATCCTCTACTCCAGAACCAGAGGAAAGGCCGCTAGCTCCCCGGAAGGAAGTGACGTCGACTCCCCAAAACTTCATGTCTTTCCAGAAGGCAAATTCCCCCAAACCTGTATATGTGAAGCCGGCAAAGGCCAGGGGCAGGCAGGTTCCCACCAAGATGGGCGGCAAATCCAAGAAAGTCACTTTCAGCCTGAACAAGAACATGACTGCCGAGTTCAAGAGGACAGACCGCAGCCTCCTTGTCAGCCCGACCGGTTCCTCCCGAGTCCCGTTTAACCCGGAGCAGAGACCAGATCACGGCGTCCTGAAAACTCCCACGTCGAGTCCCGCCCCCCGGGCCCGCGCCGCAGACTTTTTCTGA
Full Trace Sequence: gtccggaacacgtgggactggaggaggcggcggggaaacatggcttcccaggatgctgccgtgctgctggcccagagactggcggggaacgataagaagactcgggaccgggctctgcgcaaactgcggaactacctgagagtgaggagcgcgtctgactccggaggattcacagaggaggaatttatcaagatctggaaggggctgttctactgtatgtggatgcaggataaaccattattgcaggaggctttggcacaatccatgtcccagctggttcacacgctgcacacacaggaatcacagaaccttttcctgcgcacgttttggcagacgctgagccgggaatggaacgggattgatcggctgcggctggacaagttctatacgttaatgcggatggtgttgcgggagtcagtggagcttctgaagaaagctgaatgggaggagagctctgtgcaggagttcctggcgctgctgaatgaagaggtgctgaagggggcaactctgggggtgcagctccatctcatagacatttacctggaagaggtggctaaagtaggagcagcagagctcactgcggaaatgaacctgaagctgattgagcccttctgtaagatcgtagccaaaagcaagaattactccttcctgcaggccgttacctcggggatattccagactattctggagcaggctcccttcgctatagaagatttaatgaaggaaattgattccaaccccgagggcaaagagggaggttccgcaggggaggagtcaggagagaagtcagaatcagaagacaaagagtcccaagaacaggacaatgaggacattgggccagtactgcagtttgattaccaggcagtggcagacagactcttcgctctcggaagcagaaagaacttgcccactcggaaccgcaaagcagcgtatgccctggtgaaaaagttccgggacttggctgaagggatcttccccagcgaggacttcccggaggaggtttccacggacgaggatgatgatgattacagcagctggctgttccgcaagaggatgaagagggcgcaagagaatgggtcctatggaatagtatcccggctttccgacggtaacgcagtcaaggaaaaaaaacgggagaagcggaagcgagtgggcgtggctccggacgagtccaaattaaaaaatgacccccctgcagcaaaaaggaaacgtaagaggaggaagacggacgaaaacaacaacaccccgagccaggaacaagccccccaaccttcccaaaatggcgtggcccaaagctgctgtacagaaaatcacaatgaacagaaggggtcgccccaacctgccccgaccccctcaccagactgtaccccaaccctctcaaagaaaccccccgggaagaggagaagggctgggctgatccgaaccagcctccgtattctgcccctgactgggtccttactgaggaggaggcaactccggctgctcaggagcaagtgcaagatttcccagcagccaatgggatcctctactccagaaccagaggaaaggccgctagctccccggaaggaagtgacgtcgactccccaaaacttcatgtctttccagaaggcaaattcccccaaacctgtatatgtgaagccggcaaaggccaggggcaggcaggttcccaccaagatgggcggcaaatccaagaaagtcactttcagcctgaacaagaacatgactgccgagttcaagaggacagaccgcagcctccttgtcagcccgaccggttcctcccgagtcccgtttaacccggagcagagaccagatcacggcgtcctgaaaactcccacgtcgagtcccgccccccgggcccgcgccgcagactttttctgagtgttgccccgcccctagcgcacagtgaatgtggtgccttgtggttctgttcagtggatccaacccaactcaccagcagcaggagcagaatatgctgtgtccccgccagccggggacccaaggaagctgctgggccgtaccattattccctgggccgtaccattattccctgggccgtaccattattccctgggccgtaccattattccctgggccgtaccattattccctgggccgtaccattattcccagggccgtaccattattcccagggccgtaccattattcccagggccgtaccattattcccagggccgtaccattattcccagggccgtaccattattcccagggccctcactgaatgtgactttattcaaaagccgagggaggaggggtcttttaatgggcaggaaggagagatttatatttttatttaatggttgagaaggggttaaactggtattaatgagatcggtctgtgttgtatactttccttaaaaaaaaaaaaaaaaaaaagaaaaaaaaaaaaaaa
Translation: MASQDAAVLLAQRLAGNDKKTRDRALRKLRNYLRVRSASDSGGFTEEEFIKIWKGLFYCMWMQDKPLLQEALAQSMSQLVHTLHTQESQNLFLRTFWQTLSREWNGIDRLRLDKFYTLMRMVLRESVELLKKAEWEESSVQEFLALLNEEVLKGATLGVQLHLIDIYLEEVAKVGAAELTAEMNLKLIEPFCKIVAKSKNYSFLQAVTSGIFQTILEQAPFAIEDLMKEIDSNPEGKEGGSAGEESGEKSESEDKESQEQDNEDIGPVLQFDYQAVADRLFALGSRKNLPTRNRKAAYALVKKFRDLAEGIFPSEDFPEEVSTDEDDDDYSSWLFRKRMKRAQENGSYGIVSRLSDGNAVKEKKREKRKRVGVAPDESKLKNDPPAAKRKRKRRKTDENNNTPSQEQAPQPSQNGVAQSCCTENHNEQKGSPQPAPTPSPDCTPTLSKKPPGKRRRAGLIRTSLRILPLTGSLLRRRQLRLLRSKCKISQQPMGSSTPEPEERPLAPRKEVTSTPQNFMSFQKANSPKPVYVKPAKARGRQVPTKMGGKSKKVTFSLNKNMTAEFKRTDRSLLVSPTGSSRVPFNPEQRPDHGVLKTPTSSPAPRARAADFF
Donor tissue: tailbud