ORFeome > sar1a-prov – XORFeome 2.0

sar1a-prov – XORFeome 2.0

General Information

Species: Xenopus tropicalis SAR1a protein, mRNA (cDNA clone MGC:89474 IMAGE:6991786), complete cds
Gene Symbol: sar1a-prov
Gene ID: 387599
ORF gb_acc: MG133975
ORF ID: 11573

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC075541

Library Location

Plate ID: GDExt11015
Well Location: A07

EST Sequences

Clone: MGC:89474 IMAGE:6991786
Trimmed Sequence: ATGTCTTTCATATTTGAGTGGATTTATAACGGCTTCAGCAGCGTGCTGCAGTTTTTAGGATTATACAAGAAGTCTGGGAAGCTAGTGTTTTTAGGCTTGGACAATGCTGGAAAAACCACACTGCTACATATGCTAAAAGATGACAGGCTCGGTCAGCATGTTCCTACACTACATCCAACATCAGAAGAGCTGACCATTGCAGGGATGACCTTTACCACTTTTGACCTCGGTGGACATGAGCAAGCTCGTCGTGTTTGGAAGAATTATCTGCCTGCAATCAATGGAATTGTCTTTCTTGTGGACTGTGTAGATCATGGGCGCCTTATGGAGTCTAAAGTTGAGCTCAATGCACTCATGACAGATGAAACAATATCTAATGTGCCAATCCTCATCCTGGGGAACAAAATTGACAGACCAGAAGCAATCAGTGAGGAAAAACTGAGAGAAATCTTTGGATTATATGGACAGACCACAGGAAAAGGTAATGTGCCACTGAAGGATCTAAATGCTCGCCCAATGGAGGTGTTTATGTGCAGTGTGCTCAAGCGGCAAGGATATGGTGAAGGTTTCCGTTGGCTGTCCCAGTACATTGACTGA
Full Trace Sequence: ggagggttgcgcagcggatagcagggggtgagatgccctaaatgccggcacggcagcactgattgtcatggtctccgcccagcgccccacaacccttgtttcgcgcatagccccattgtactttagctgctggagggccacaaagattgatacccaactgttacggataaacattcagaaatgtctttcatatttgagtggatttataacggcttcagcagcgtgctgcagtttttaggattatacaagaagtctgggaagctagtgtttttaggcttggacaatgctggaaaaaccacactgctacatatgctaaaagatgacaggctcggtcagcatgttcctacactacatccaacatcagaagagctgaccattgcagggatgacctttaccacttttgacctcggtggacatgagcaagctcgtcgtgtttggaagaattatctgcctgcaatcaatggaattgtctttcttgtggactgtgtagatcatgggcgccttatggagtctaaagttgagctcaatgcactcatgacagatgaaacaatatctaatgtgccaatcctcatcctggggaacaaaattgacagaccagaagcaatcagtgaggaaaaactgagagaaatctttggattatatggacagaccacaggaaaaggtaatgtgccactgaaggatctaaatgctcgcccaatggaggtgtttatgtgcagtgtgctcaagcggcaaggatatggtgaaggtttccgttggctgtcccagtacattgactgaattttccctcctcccccactacttctttcctttccttggatcggcaagaaaataaaaacaaggttatgctgagttcgactcctctggactttatcctgacggacttctctttcagagtgaggcagactcacacaggcagtgattaacacagtgcaacaaccaggagtcttgtggggaaacttcgctctgatcaagagttaattgatttcaacagaaaacaagtctattttttaaagaatgtccatgtaaactgtgccccttcagctttttttttttcttttaaatcactttgtttggtccagagtttgtattaggctttttttttttttaatctacatatttaatggtatttagatatttcacaacaacaatgctgaaccaagtttcatgacattagaagtccgcaataaacatacttttgcgctggaaaaaaaaaaaaaaaaaaaa
Translation: MSFIFEWIYNGFSSVLQFLGLYKKSGKLVFLGLDNAGKTTLLHMLKDDRLGQHVPTLHPTSEELTIAGMTFTTFDLGGHEQARRVWKNYLPAINGIVFLVDCVDHGRLMESKVELNALMTDETISNVPILILGNKIDRPEAISEEKLREIFGLYGQTTGKGNVPLKDLNARPMEVFMCSVLKRQGYGEGFRWLSQYID
Donor tissue: neurula