ORFeome > sar1a – XORFeome 2.0

sar1a – XORFeome 2.0

General Information

Species: Xenopus tropicalis SAR1a protein, mRNA (cDNA clone MGC:76158 IMAGE:5335397), complete cds
Gene Symbol: sar1a
Gene ID: 387599
ORF gb_acc: MG132756
ORF ID: 10060

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC063212

Library Location

Plate ID: GDExt11001
Well Location: E04

EST Sequences

Clone: MGC:76158 IMAGE:5335397
Trimmed Sequence: ATGTCTTTCATATTTGAGTGGATTTATAACGGCTTCAGCAGCGTGCTGCAGTTTTTAGGATTATACAAGAAGTCTGGGAAGCTAGTGTTTTTAGGCTTGGACAATGCTGGAAAAACCACACTGCTACATATGCTAAAAGATGACAGGCTCGGTCAGCATGTTCCTACACTACATCCAACATCAGAAGAGCTGACCATTGCAGGGATGACCTTTACCACTTTTGACCTCGGTGGACATGAGCAAGCTCGTCGTGTTTGGAAGAATTATCTGCCTGCAATCAATGGAATTGTCTTTCTTGTGGACTGTGTAGATCATGGGCGCCTTATGGAGTCTAAAGTTGAGCTCAATGCACTCATGACAGATGAAACAATATCTAATGTGCCAATCCTCATCCTGGGGAACAAAATTGACAGACCAGAAGCAATCAGTGAGGAAAAACTGAGAGAAATCTTTGGATTATATGGACAGACCACAGGAAAAGGTAATGTGCCACTGAAGGATCTAAATGCTCGCCCAATGGAGGTGTTTATGTGCAGTGTGCTCAAGCGGCAAGGATATGGTGAAGGTTTCCGTTGGCTGTCCCAGTACATTGACTGA
Full Trace Sequence: gcggtatctacactcttactatccagagagtgttgaaggccccgggccgggagacgccgccaccgggaacaaaacggggagaagccgagaaacaagagaaggataaacattcagaaatgtctttcatatttgagtggatttataacggcttcagcagcgtgctgcagtttttaggattatacaagaagtctgggaagctagtgtttttaggcttggacaatgctggaaaaaccacactgctacatatgctaaaagatgacaggctcggtcagcatgttcctacactacatccaacatcagaagagctgaccattgcagggatgacctttaccacttttgacctcggtggacatgagcaagctcgtcgtgtttggaagaattatctgcctgcaatcaatggaattgtctttcttgtggactgtgtagatcatgggcgccttatggagtctaaagttgagctcaatgcactcatgacagatgaaacaatatctaatgtgccaatcctcatcctggggaacaaaattgacagaccagaagcaatcagtgaggaaaaactgagagaaatctttggattatatggacagaccacaggaaaaggtaatgtgccactgaaggatctaaatgctcgcccaatggaggtgtttatgtgcagtgtgctcaagcggcaaggatatggtgaaggtttccgttggctgtcccagtacattgactgaattttccctcctcccccactacttctttcctttccttggatcggcaagaaaataaaaacaaggttatgctgagttcgactcctctggactttatcctgacggacttctctttcagagtgaggcagactcacacaggcagtgattaacacagtgcaacaaccaggagtcttgtggggaaacttcgctctgatcaagagttaattgatttcaacagaaaacaagtctattttttaaagaatgtccatgtaaactgtgccccttcagctttttttttttcttttaaatcactttgtttggtccagagtttgtattaggcttttttttttttaatctacatatttaatggtatttagatatttcacaacaacaatgctgaaccaagtttcatgacattagaagtccgcaataaacatacttttgcgctggcatgctcttcaacaatggttttgctttggcagcctggctgatgtctgattggtggtggggtataaaaagggagcctcatcaggagttgacacttttacatttttggtttttgctgaatggagtgaaagtgagagaggtcattaaaataacacttactactatgtttttattcttgtgcccgatctgggtatataggtgcataaattagtcctaaccgttaatacacatatttgcctggtctttaatgtagtatatctccaaaagtataaaatatataagggtgcatgccctctgaaggaactgtatattatgagtagtttattattttgtattacccttaaagcagtcttatagtggccttgtagccaccgggttacccaaaagtggcaatttataaagaatatgctgtaaagtaaaaaataaatctttgattctcccattgatacatttttcaatatgtagcctagaggctaggcaagaggtgcgcagagcagtgtctacttctagtgaacttatcctcagttgtaccaggtcaggtacattgtgacactgctgtttcagtgccatgggtaatttaaatgaaataccttcagttgtgagaaagtacacattgctgtattttatgtacacaacccttccatctagtcaatttttttttttttcaaaagcacataagagcatactgtgcagagcagtttgtagacatgcgttgatgtcagctggtcaaatgctaccttttgagcaggaaaggcttagatgtgcttgcagcagttttcaaatgccatgggtcaattagttgccatattgcaaatttgacggatagattattagaacatgatgtcctacaaagaagcctgtggagccctttagaagactgggtgacataaaattcccatgaagggcctgatcaggctagtggacctccttttggacagtcatggtcttgacaaagaattcaaactttgttgttttggttacatatattttcttcggatagttagggctatgttgatttagaatactagaagggggatggagtaatagcttcttgcaaactggtaaagaaatttcattgctaactttttacaaatgagggataatttaattctaatatgatggtattaacatacatataggtaaggatatttctttggcaagacaaaacccacttctgtccatctattccctgtatatggacttgaatgcaagaatattttgatgtatgaaaatactctgtgtaacataaaccatcctgtgcttcacaataaagccctggttttctttgcttgccagcatttaatttgcaacacgtttatctagaactccaataaaatggtcatgtgataataaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MSFIFEWIYNGFSSVLQFLGLYKKSGKLVFLGLDNAGKTTLLHMLKDDRLGQHVPTLHPTSEELTIAGMTFTTFDLGGHEQARRVWKNYLPAINGIVFLVDCVDHGRLMESKVELNALMTDETISNVPILILGNKIDRPEAISEEKLREIFGLYGQTTGKGNVPLKDLNARPMEVFMCSVLKRQGYGEGFRWLSQYID
Donor tissue: tailbud