ORFeome > sec14l1 – XORFeome 2.0

sec14l1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis sec14l1 protein, mRNA (cDNA clone MGC:79619 IMAGE:6979761), complete cds
Gene Symbol: sec14l1
Gene ID: 493292
ORF gb_acc:
ORF ID: 11147

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC080346

Library Location

Plate ID: GDExt11012
Well Location: G01

EST Sequences

Clone: MGC:79619 IMAGE:6979761
Trimmed Sequence: ATGGTGCAGAAATACCAGTCGCCCGTCCGCGTGTATAAGCACGGCTTTGAGCTGATTATGGCCGCGTACGAGCGGCGTTTCCCCACCTGTCCCCTCATCCCCATGTTTGTTGGCAGCGACCTAATGAACGAATACAAGAGTGAGGATGGAGCTGTACATATCGTAGAGAGGCGCTGCAAGCTGGACGTGGATGCTCCGCGCCTCTTGAAGAAAATAGCTGGAGTGGATTATGTTTACTTTATCCAGAAGAACTCTCTGAACCGCCAGGAGCGTACTCTGCACATTGAGGCTTACAATGAGACCTTCTCTAGTAGGATTATAGTCAATGAGCACTGCTGTTACACTGTACACCCTGATAATGAAAACTGGACTTGCTTCGAACAGTCGGCCAGCCTGGACATCAAGTCCTTCTTTGGATTTGAGAGCACTGTGGAAAAGATTGCAATGAAGCAGTACACAACAAACATAAAAAAGGGCAAAGAAATCATTGAATATTACTTGAACCAGTTGGAGCAGGAGGGTATCACCTCCATGCCTCGCTGGACTCCTGAAATCGCTCAGCGGCAAGAAACCAAAACAGATACCTCAGGCCGGGCCATGTCTCCCCCTCAGAGCATACCCACAAAATCTGCCGATGGGCCCAGCAGCAAAGATGGCTTACCATCCAGCCCCACCGCTGCAACCCATGAGCTGAGCAGCACACCCGATGATAAGCTGGATGCTGATTACATTAAACGTTACTTGGGAGATCTCACCCCTCTTCAGGAAAGCTGCCTAATCCGCCTGCGTCAGTGGCTACAGGAAACCCACAAGGGCAAAATTCCCAAAGATGAGCACATATTGAGATTTTTGCGAGCCCGCGACTTCAACATCGACAAAGCTCGGGAAATCCTCTGCCAATCCCTCACCTGGAGAAAGCAGCACCATGTCGACTACCTGCTGAGCACGTGGGACCCTCCCCAGGTGTTACACGATTACTATGCTGGAGGCTGGCACCACCACGACAGAGATGGGCGCCCGCTGTATGTGCTGAGACTTGGACAGATGGATACCAAGGGTCTGGTCAGGGCACTTGGGGAAGAGTCCCTCCTTCGACATGTGCTGTCAATCAATGAGGAAGGACTAAGGCGCTGTGAAGAGAACACGAACATCTTTGGGCGCCCCATCAGCTCTTGGACCTGTCTAGTTGACCTGGAAGGTCTAAACATGAGGCATCTATGGAGGCCAGGAGTCAAAGCCTTGCTGCGCATTATTGAGGTTGTTGAAGCAAATTACCCAGAGACCCTTGGTCGGTTACTGATCCTGCGGGCTCCCAGAGTGTTTCCGGTCCTCTGGACTCTGGTCAGTCCCTTCATTGATGAGAATACCAGAAAGAAATTTCTTATTTATGCTGGGAATGATTACCAAGGTCCGGGTGGGCTGATTGATTACATTGACAAAGAGGTCATTCCTGACTTCCTGGGAGGGGAGTGTATGTGTGAAGTGTCAGAGGGCGGAATGGTCCCCAAGGCTCTCTACAGGACCCCAGAAGAACTAGAGAATGATGATATCCGATTGTGGACAGAGACCATATATCAATCTGCTAGTGTATTTAAGGGCTCACCGCATGAGATATTGATCCAGATAGTTGATGCCTCTTCTGTCATCACCTGGGACTTTGATGTGTGTAAAGGGGATATCGTGTTCAACATCTACCATTCCAAGCGGGCCCCCCAGGCGCCCAAGAGGGACACACTTGGAGCCCATGGCATCACCTCTCCTGTGGGCAACAATGTGCAGCTGATTGACAAAGCTTGGCAGTTGGGGCGGGATTACAGCATGGTGGAATCTCCGCTAATCTGCAAGGAAGGAGAGAGTGTGCAGGGTTCCCACGTGACCCGCTGGCCGGGTTTTTACATCCTGCAGTGGAAGTTCCACAGTATGCCAGCCTGTGCCACCAGTAGTCTCCCCCGGGTGGAGGATGTGCTCGCCTCCCTTCAGGTCTCCTCTCACAAGTGCAAAGTCATGTATTACACAGAGATCATTGGCTCAGAGGATTTCAGGGGCTCCATGACCAGCCTGGAATCCAGCCATAGTGGCTTCTCTCAGCTCAGCGCTGCCACCACCTCCTCAAGCCAGTCACACTCCAGTTCCATGGTTTCCAGGTAG
Full Trace Sequence: gtcaaccggctgctctgtggaaccggggcccggctgcggggtatacggaccggtcagcacggagagatgtgttacatggaattgttacacgtatgatcggccacctttgctgccaattaacctgggacttaatgaagattccttttaggtaactaacgtgccaaaaagaacaagcaaccatggtgcagaaataccagtcgcccgtccgcgtgtataagcacggctttgagctgattatggccgcgtacgagcggcgtttccccacctgtcccctcatccccatgtttgttggcagcgacctaatgaacgaatacaagagtgaggatggagctgtacatatcgtagagaggcgctgcaagctggacgtggatgctccgcgcctcttgaagaaaatagctggagtggattatgtttactttatccagaagaactctctgaaccgccaggagcgtactctgcacattgaggcttacaatgagaccttctctagtaggattatagtcaatgagcactgctgttacactgtacaccctgataatgaaaactggacttgcttcgaacagtcggccagcctggacatcaagtccttctttggatttgagagcactgtggaaaagattgcaatgaagcagtacacaacaaacataaaaaagggcaaagaaatcattgaatattacttgaaccagttggagcaggagggtatcacctccatgcctcgctggactcctgaaatcgctcagcggcaagaaaccaaaacagatacctcaggccgggccatgtctccccctcagagcatacccacaaaatctgccgatgggcccagcagcaaagatggcttaccatccagccccaccgctgcaacccatgagctgagcagcacacccgatgataagctggatgctgattacattaaacgttacttgggagatctcacccctcttcaggaaagctgcctaatccgcctgcgtcagtggctacaggaaacccacaagggcaaaattcccaaagatgagcacatattgagatttttgcgagcccgcgacttcaacatcgacaaagctcgggaaatcctctgccaatccctcacctggagaaagcagcaccatgtcgactacctgctgagcacgtgggaccctccccaggtgttacacgattactatgctggaggctggcaccaccacgacagagatgggcgcccgctgtatgtgctgagacttggacagatggataccaagggtctggtcagggcacttggggaagagtccctccttcgacatgtgctgtcaatcaatgaggaaggactaaggcgctgtgaagagaacacgaacatctttgggcgccccatcagctcttggacctgtctagttgacctggaaggtctaaacatgaggcatctatggaggccaggagtcaaagccttgctgcgcattattgaggttgttgaagcaaattacccagagacccttggtcggttactgatcctgcgggctcccagagtgtttccggtcctctggactctggtcagtcccttcattgatgagaataccagaaagaaatttcttatttatgctgggaatgattaccaaggtccgggtgggctgattgattacattgacaaagaggtcattcctgacttcctgggaggggagtgtatgtgtgaagtgtcagagggcggaatggtccccaaggctctctacaggaccccagaagaactagagaatgatgatatccgattgtggacagagaccatatatcaatctgctagtgtatttaagggctcaccgcatgagatattgatccagatagttgatgcctcttctgtcatcacctgggactttgatgtgtgtaaaggggatatcgtgttcaacatctaccattccaagcgggccccccaggcgcccaagagggacacacttggagcccatggcatcacctctcctgtgggcaacaatgtgcagctgattgacaaagcttggcagttggggcgggattacagcatggtggaatctccgctaatctgcaaggaaggagagagtgtgcagggttcccacgtgacccgctggccgggtttttacatcctgcagtggaagttccacagtatgccagcctgtgccaccagtagtctcccccgggtggaggatgtgctcgcctcccttcaggtctcctctcacaagtgcaaagtcatgtattacacagagatcattggctcagaggatttcaggggctccatgaccagcctggaatccagccatagtggcttctctcagctcagcgctgccaccacctcctcaagccagtcacactccagttccatggtttccaggtagccggcccttgcacctgtaaccccaccgtgccacagatttctcctcctacccccactgaagcctcatctcaccaattcttcccccccactccctttatgagaaccctcttaatttatgggagggagtaagtgggctagacttgccatgggagttactctagacctgttgctaattagcacttaataatctagagtttctacggcctctatgttgaccatcctgccttatggctggaagctcttggatatatatataactaaagctttttgatcacctttatccacgttttgtatgtgtttggttttggcggggggtttgtaaagttgtttgaatgttggaaaagagttaaacataaatctgtattaaatttgtataaaaatgcaaaaaaaaaaaaaaaaaaa
Translation: MVQKYQSPVRVYKHGFELIMAAYERRFPTCPLIPMFVGSDLMNEYKSEDGAVHIVERRCKLDVDAPRLLKKIAGVDYVYFIQKNSLNRQERTLHIEAYNETFSSRIIVNEHCCYTVHPDNENWTCFEQSASLDIKSFFGFESTVEKIAMKQYTTNIKKGKEIIEYYLNQLEQEGITSMPRWTPEIAQRQETKTDTSGRAMSPPQSIPTKSADGPSSKDGLPSSPTAATHELSSTPDDKLDADYIKRYLGDLTPLQESCLIRLRQWLQETHKGKIPKDEHILRFLRARDFNIDKAREILCQSLTWRKQHHVDYLLSTWDPPQVLHDYYAGGWHHHDRDGRPLYVLRLGQMDTKGLVRALGEESLLRHVLSINEEGLRRCEENTNIFGRPISSWTCLVDLEGLNMRHLWRPGVKALLRIIEVVEANYPETLGRLLILRAPRVFPVLWTLVSPFIDENTRKKFLIYAGNDYQGPGGLIDYIDKEVIPDFLGGECMCEVSEGGMVPKALYRTPEELENDDIRLWTETIYQSASVFKGSPHEILIQIVDASSVITWDFDVCKGDIVFNIYHSKRAPQAPKRDTLGAHGITSPVGNNVQLIDKAWQLGRDYSMVESPLICKEGESVQGSHVTRWPGFYILQWKFHSMPACATSSLPRVEDVLASLQVSSHKCKVMYYTEIIGSEDFRGSMTSLESSHSGFSQLSAATTSSSQSHSSSMVSR
Donor tissue: tailbud