ORFeome > sec31a – XORFeome 2.0

sec31a – XORFeome 2.0

General Information

Species: Xenopus tropicalis SEC31 homolog A, mRNA (cDNA clone MGC:79594 IMAGE:6979112), complete cds
Gene Symbol: sec31a
Gene ID: 496576
ORF gb_acc: MG134294
ORF ID: 11966

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC084914

Library Location

Plate ID: GDExt11018
Well Location: G10

EST Sequences

Clone: MGC:79594 IMAGE:6979112
Trimmed Sequence: ATGAAGCTCAAAGAGATTGATCGTACAGCAATGCAAGCGTGGAGCCATTCTCAGTATCACCCTATATATCTTGCAACAGGAACATCGGCTCAACAACTTGATGCAACTTTTAGCACAAATGCTTCCCTGGAGATATTTGAATTGGACTTGGCAGATCCTTCAATGGATATGAAGTCATGTGCCACATTTTCATCCACACACAGGTACCATAAACTAATTTGGGGTCCACACAGAACGGCATCTAATGGCAGTGCTTCTGGAGTCCTTATTGCTGGAGGAGAAAATGGAAATGTGATTCTTTATGACCCAGCAAAGATCATCGAAGGAGACCGTGAAGTTGTCATCGCTCAGCAAGACAAGCACACAGGACCAGTGCGAGCCCTGGATGTAAACTCATTCCAGACAAATCTTGTAGCATCGGGTGCGAATGAGTCTGAAATATATATCTGGGACCTTAATAACTTTGCTGTTCCAATGACGCCGGGTGCTAAATCTCAGCCACTGGAAGATATCGGCTGTATTGCCTGGAACCGACAGGTCCAACACATTCTTGCCTCTGCCAGCCCCAGTGGACGGGCTACAGTGTGGGATCTCAGGAAAAATGAACCAATACTAAAAGTCAGCGACCACAGCAATAGGATGCACTGCTCTGGCATGGCCTGGCATCCAGATGTTGCCACCCAGATGGTCCTTTCTTCAGAAGATGATCGCTTGCCTGTAATACAGATGTGGGACCTCCGATTTGCCTCCTCTCCTCTGCGTGTTATTGAGAGCCACACCAGAGGAATTTTGGCCATTGCTTGGAGCTTGGCAGATCCAGAACTGCTGCTTAGCTCTGGGAAGGATTCCAGAATACTCTGCTCCAATCCCAACACAGGAGAGGTTTTGTATGAGTTACCAACAAACATGCAGTGGTGTTTTGATATGCAGTGGTGTCCTAGGAACCCTGCAGTTCTTTCTGCTGCTTCATTTGATGGTCGCATCAGCATTTACTCCATTATGGGTGGAAACAATGACAGTCTGAGTCAGAAGCAGGCAGACAAGCTTTCTTCATCATTTGGGAACCTGGATCCTTTTGGTACAGGACATCCACTGCCACCACTGCAGCTTCCTCAGCAGCCTACACAGCAAAATACTATTGTTCCACTTAAAAAGCCTCCTAAGTGGATGCGCTGCCCAGTCGGAGCCTCATTCTCTTTTGGAGGAAAGCTGGTCACATTTGAGACTGTGAATACACAAACAGCCCAACAGCAGCAGCACCCGGAGGCCGAGCCTCATCATTTTCATGTGTATGTCAGTCAAGTGGTAACCGAGAAAGAGTTCCTGACAAGATCTAACCAGTTACAGGACGTGGTCAGCACTGGTACTTTTATAGACTACTGTCAGAAGAAAGTTGAAGATGCCAAGACAGACTTCGAGAAGGATGTGTGGTCATTCCTAAAGGTAAATTTTGAAGAGGATACTCGCGGCAAGTACCTTGAGCTGCTTGGATTCAGAAAGGATGACCTAAGCTCTAAGATTGCATCTGTTATGGGCAACGAATATGCAACAGATGGTGATCATGAGGCTGAGAAAGACTCTGACCAAGCTATTGCAAGTGATGAGGAAGAGAGACAACATTCAGAGGATAATTTCTTGGCGGAGGTTTCCAAAGATGACAAAAGACAGAGTAGCGGATCAAACTCCCCTGGAGAATCATTGAATATATTGGTTAGCGGAGATGTTGATGGCCTCATCACTCAAGCTCTGCTCACTGGGAACTTTGAAAGTGCTGTGAATTTGTGTTTGCATGATAATCGCATGGCAGATGCTGTTATATTAGCCATTGCAGGTGGACCAGAGCTGTTGGCTAAAACACAAAGAAAGTACTTTGCCAAATCACAAAGCAAGATAACCAGGCTGATCACAGCAGTAGTGACTAAGAATTGGAATGAGATTGTTCAGTCCTGTGATCTGAAGAACTGGAGAGAAGCTCTAGCTGCAGTGTTAACCTATACAAAGCCTGATGAGTTTTCTTCGTTATGTGATTTGCTGGGCTCCAGACTGGAGAATGAAGGAGACATAGCACTTCAGACACAGGCATGTCTCTGCTATATCTGTGCAGGCAATGTGGAGAAGCTGGTTTCTTGTTGGACTAAGGCTCACGATAGCAATTGCTCTTTAGCTCTTCAGGATCTTATAGAAAAGGTGGTTATCCTACGCAAAGCAGTGGAAACAAATGATATGGGAACCATTCTGTCCCAGAAGATGAGCCAGTATGCCAATGTATTGGCAGCTCAGGGCAGTCTTGCTGCTGCTATGGCTTTTCTCCCCACCGACGCACATCAAGGTGATGTTGTGCAGTTACGGGAAAGGCTATGCCGTGCACAAGGACAGGTTAATATTATTGCTCCTGCTGCTGGGGTGACTCGAAGTGGAAGTACACAACAACATGGTGCAAAAACCTGTGCAGCCTGGGACTGA
Full Trace Sequence: gtgcatacccctattttcattttagtatattactattctgattcctttattttacatttccgtaacgcacccgctttctacttgtgctttggttttatagttattgcatagttacctggcgttgaagcaagatacaataagagaatgaagctcaaagagattgatcgtacagcaatgcaagcgtggagccattctcagtatcaccctatatatcttgcaacaggaacatcggctcaacaacttgatgcaacttttagcacaaatgcttccctggagatatttgaattggacttggcagatccttcaatggatatgaagtcatgtgccacattttcatccacacacaggtaccataaactaatttggggtccacacagaacggcatctaatggcagtgcttctggagtccttattgctggaggagaaaatggaaatgtgattctttatgacccagcaaagatcatcgaaggagaccgtgaagttgtcatcgctcagcaagacaagcacacaggaccagtgcgagccctggatgtaaactcattccagacaaatcttgtagcatcgggtgcgaatgagtctgaaatatatatctgggaccttaataactttgctgttccaatgacgccgggtgctaaatctcagccactggaagatatcggctgtattgcctggaaccgacaggtccaacacattcttgcctctgccagccccagtggacgggctacagtgtgggatctcaggaaaaatgaaccaatactaaaagtcagcgaccacagcaataggatgcactgctctggcatggcctggcatccagatgttgccacccagatggtcctttcttcagaagatgatcgcttgcctgtaatacagatgtgggacctccgatttgcctcctctcctctgcgtgttattgagagccacaccagaggaattttggccattgcttggagcttggcagatccagaactgctgcttagctctgggaaggattccagaatactctgctccaatcccaacacaggagaggttttgtatgagttaccaacaaacatgcagtggtgttttgatatgcagtggtgtcctaggaaccctgcagttctttctgctgcttcatttgatggtcgcatcagcatttactccattatgggtggaaacaatgacagtctgagtcagaagcaggcagacaagctttcttcatcatttgggaacctggatccttttggtacaggacatccactgccaccactgcagcttcctcagcagcctacacagcaaaatactattgttccacttaaaaagcctcctaagtggatgcgctgcccagtcggagcctcattctcttttggaggaaagctggtcacatttgagactgtgaatacacaaacagcccaacagcagcagcacccggaggccgagcctcatcattttcatgtgtatgtcagtcaagtggtaaccgagaaagagttcctgacaagatctaaccagttacaggacgtggtcagcactggtacttttatagactactgtcagaagaaagttgaagatgccaagacagacttcgagaaggatgtgtggtcattcctaaaggtaaattttgaagaggatactcgcggcaagtaccttgagctgcttggattcagaaaggatgacctaagctctaagattgcatctgttatgggcaacgaatatgcaacagatggtgatcatgaggctgagaaagactctgaccaagctattgcaagtgatgaggaagagagacaacattcagaggataatttcttggcggaggtttccaaagatgacaaaagacagagtagcggatcaaactcccctggagaatcattgaatatattggttagcggagatgttgatggcctcatcactcaagctctgctcactgggaactttgaaagtgctgtgaatttgtgtttgcatgataatcgcatggcagatgctgttatattagccattgcaggtggaccagagctgttggctaaaacacaaagaaagtactttgccaaatcacaaagcaagataaccaggctgatcacagcagtagtgactaagaattggaatgagattgttcagtcctgtgatctgaagaactggagagaagctctagctgcagtgttaacctatacaaagcctgatgagttttcttcgttatgtgatttgctgggctccagactggagaatgaaggagacatagcacttcagacacaggcatgtctctgctatatctgtgcaggcaatgtggagaagctggtttcttgttggactaaggctcacgatagcaattgctctttagctcttcaggatcttatagaaaaggtggttatcctacgcaaagcagtggaaacaaatgatatgggaaccattctgtcccagaagatgagccagtatgccaatgtattggcagctcagggcagtcttgctgctgctatggcttttctccccaccgacgcacatcaaggtgatgttgtgcagttacgggaaaggctatgccgtgcacaaggacaggttaatattattgctcctgctgctggggtgactcgaagtggaagtacacaacaacatggtgcaaaaacctgtgcagcctgggactgacatgcagtattacccacagagaaacagtgcactgcctcttgggtttaatattcctggttccacatatacctctggttcactggcttcagtagcctcagcggattctagtgctccctcttacaacatcaactctcagattactcctagacttccttactcacagccctatttacaatcgcagcagtattcttatggcatggggggtcctgctgtctatcagccccaaccaccatctactgttccttctgctacgccctaccacaattcttcttatacctcagcttcccaaactacaactcagccactgtaccctgggcctgctctgctttctcctgcctcttccgcctcttcttctcttcctccttctagtggtgcatccttccagcatggtggaccaggagccccagctaacactgcacattgcgcactgcctcctcctggatctacaggtactctgcctgccaccagtgagctgcctgcatcccagagaacaggtcctctgaatggatggaatgatccacccgcattgagcaggatttcgaaaaagaaggtcctagaaaattatgtacctccacctccaattactgctcccataatgaaccctgtgacagacccaagctcccagcagcaacagatcccagcctctggaacacagatgccctctataccctttcagccttcgacaatgcttgtagcacaacctggtacccagacttcctttccaatatcacagccctgcaacagtcaacctggactgccccttgagtcctcaaagcccagtatggagggtgcccctggagcacccattggcaataccattcaggctattcatactctaccagctgaaaaaattgtcaagaatccaattcctggagaacacctgattctaaagactacatttgaggctcttatccaaagatgcttgtgttctgcaaatgacccgcaaaccaagcggaagctagatgatgcaaataaacgcctagaatatctttatgataaactgcgagagcaaacgctttcccctgcaataattgcaggattgcacaacattgccagaagtattgaatctcggaactacacagaaggactaaacatacacacccacattgtgagcaccagtaactttagtgaaacatctgcttttatgccagttctgaaagtagttctaacccaggccaacaagcttggggtgtaaaaatgtttctcagagacttgatacattgctgcaaaggaacagtccctgcttcctcttttagatgatggaccaagaacaaacatgtttttaatctactgcaactcaaaattggctgtgtcttgcaaagcaaatttctgcctttttatttttggactaatgaattttacaaagaaattctccagtgatcattgtttttgatgaaatatattatgttgcggaaaccagtattgttttattaaatacctgcccatttttgtggtattttttttttttaactgatcaccattttcaaggtacacgtgaagctctttggaaaattgtatcacgtagaataaagtgtgtgaccacaaatcatgatgtaacatgcatttcaagccagtagacctgtacgatttaaaatatataatatatatatgtaacccttaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MKLKEIDRTAMQAWSHSQYHPIYLATGTSAQQLDATFSTNASLEIFELDLADPSMDMKSCATFSSTHRYHKLIWGPHRTASNGSASGVLIAGGENGNVILYDPAKIIEGDREVVIAQQDKHTGPVRALDVNSFQTNLVASGANESEIYIWDLNNFAVPMTPGAKSQPLEDIGCIAWNRQVQHILASASPSGRATVWDLRKNEPILKVSDHSNRMHCSGMAWHPDVATQMVLSSEDDRLPVIQMWDLRFASSPLRVIESHTRGILAIAWSLADPELLLSSGKDSRILCSNPNTGEVLYELPTNMQWCFDMQWCPRNPAVLSAASFDGRISIYSIMGGNNDSLSQKQADKLSSSFGNLDPFGTGHPLPPLQLPQQPTQQNTIVPLKKPPKWMRCPVGASFSFGGKLVTFETVNTQTAQQQQHPEAEPHHFHVYVSQVVTEKEFLTRSNQLQDVVSTGTFIDYCQKKVEDAKTDFEKDVWSFLKVNFEEDTRGKYLELLGFRKDDLSSKIASVMGNEYATDGDHEAEKDSDQAIASDEEERQHSEDNFLAEVSKDDKRQSSGSNSPGESLNILVSGDVDGLITQALLTGNFESAVNLCLHDNRMADAVILAIAGGPELLAKTQRKYFAKSQSKITRLITAVVTKNWNEIVQSCDLKNWREALAAVLTYTKPDEFSSLCDLLGSRLENEGDIALQTQACLCYICAGNVEKLVSCWTKAHDSNCSLALQDLIEKVVILRKAVETNDMGTILSQKMSQYANVLAAQGSLAAAMAFLPTDAHQGDVVQLRERLCRAQGQVNIIAPAAGVTRSGSTQQHGAKTCAAWD
Donor tissue: tailbud