ORFeome > sec61a1 – XORFeome 2.0

sec61a1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis Sec61 alpha 1 subunit (S. cerevisiae), mRNA (cDNA clone MGC:69436 IMAGE:5335742), complete cds
Gene Symbol: sec61a1
Gene ID: 448033
ORF gb_acc: MG133412
ORF ID: 10922

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC074553

Library Location

Plate ID: GDExt11008
Well Location: G06

EST Sequences

Clone: MGC:69436 IMAGE:5335742
Trimmed Sequence: ATGGGCATTAAATTTCTTGAAGTCATCAAGCCATTCTGTGCAATACTACCAGAAATCCAAAAGCCAGAAAGAAAGATCCAATTTAAGGAAAAAGTACTATGGACTGCCATCACTTTGTTCATCTTCTTAGTATGTTGCCAGATCCCACTCTTTGGTATTATGTCCTCGGATTCCGCTGATCCTTTCTACTGGATGAGAGTCATTTTGGCTTCCAACAGAGGTACCCTTATGGAGCTCGGTATCTCTCCCATTGTCACCTCTGGTCTAATCATGCAGCTTCTAGCTGGTGCCAAGATTATTGAGGTTGGAGACACTCCTAAGGACCGCGCTCTCTTCAATGGTGCTCAGAAATTATTTGGAATGATCATCACCATCGGTCAAGCCATTGTGTATGTCATGACTGGAATGTATGGGGATCCTTCAGAGATGGGGGCTGGCATCTGTCTTCTTATCACCATCCAGCTCTTTGTTGCTGGCCTGATTGTCTTGCTCCTGGATGAATTGCTACAGAAAGGCTATGGTCTGGGCTCTGGTATCTCTCTCTTCATTGCTACAAACATCTGCGAAACCATTGTATGGAAGGCATTCAGTCCAACTACTGTGAACACAGGCAGAGGCACTGAGTTTGAGGGAGCAATCATTGCCCTGTTCCACTTGCTTGCCACACGTACTGACAAAGTCCGCGCTCTGAGGGAGGCCTTCTATCGCCAGAACCTGCCAAATCTCATGAACCTCATCGCTACCATTTTCGTTTTCGCAGTAGTCATATACTTCCAGGGCTTTAGAGTGGATCTTCCAATCAAGTCAGCCCGGTACCGTGGCCAGTACAACACTTACCCAATCAAGCTTTTCTATACTTCTAACATCCCCATCATTCTCCAGTCTGCCCTGGTCTCAAATCTGTACGTTATCTCCCAGATGCTGTCTGCCCGTTTCAGTGGCAACCTCCTTGTCAACTTATTGGGCACATGGTCTGATGCAACGACTGGAGGTCCTGCTCGGGCCTATCCTGTAGGCGGGTTATGTTATTACCTCTCACCGCCGGAATCATTTGGTTCGGTACTGGACGATCCGGTTCATGCAGTGGTTTACATAGTCTTCATGCTGGGATCCTGCGCATTCTTCTCCAAGACCTGGATAGAAGTGTCTGGCTCTTCTGCAAAGGATGTTGCAAAACAACTAAAAGAACAGCAGATGGTAATGAGAGGCCACCGGGAGACATCCATGGTGCATGAACTCAATAGATACATCCCAACCGCGGCTGCTTTTGGAGGTCTTTGCATTGGAGCGCTCTCCGTCCTGGCAGACTTCCTGGGAGCCATTGGTTCTGGAACTGGTATCCTATTGGCCGTCACTATCATCTATCAGTATTTCGAGATCTTCGTCAAAGAACAGAGCGAAGTGGGAAGCATGGGAGCATTGCTTTTCTAG
Full Trace Sequence: cgcggcgcaacaggaccggtcccccagcccgtcacacccctagaggccactgagcccaccgcaacaccttcaccatgggcattaaatttcttgaagtcatcaagccattctgtgcaatactaccagaaatccaaaagccagaaagaaagatccaatttaaggaaaaagtactatggactgccatcactttgttcatcttcttagtatgttgccagatcccactctttggtattatgtcctcggattccgctgatcctttctactggatgagagtcattttggcttccaacagaggtacccttatggagctcggtatctctcccattgtcacctctggtctaatcatgcagcttctagctggtgccaagattattgaggttggagacactcctaaggaccgcgctctcttcaatggtgctcagaaattatttggaatgatcatcaccatcggtcaagccattgtgtatgtcatgactggaatgtatggggatccttcagagatgggggctggcatctgtcttcttatcaccatccagctctttgttgctggcctgattgtcttgctcctggatgaattgctacagaaaggctatggtctgggctctggtatctctctcttcattgctacaaacatctgcgaaaccattgtatggaaggcattcagtccaactactgtgaacacaggcagaggcactgagtttgagggagcaatcattgccctgttccacttgcttgccacacgtactgacaaagtccgcgctctgagggaggccttctatcgccagaacctgccaaatctcatgaacctcatcgctaccattttcgttttcgcagtagtcatatacttccagggctttagagtggatcttccaatcaagtcagcccggtaccgtggccagtacaacacttacccaatcaagcttttctatacttctaacatccccatcattctccagtctgccctggtctcaaatctgtacgttatctcccagatgctgtctgcccgtttcagtggcaacctccttgtcaacttattgggcacatggtctgatgcaacgactggaggtcctgctcgggcctatcctgtaggcgggttatgttattacctctcaccgccggaatcatttggttcggtactggacgatccggttcatgcagtggtttacatagtcttcatgctgggatcctgcgcattcttctccaagacctggatagaagtgtctggctcttctgcaaaggatgttgcaaaacaactaaaagaacagcagatggtaatgagaggccaccgggagacatccatggtgcatgaactcaatagatacatcccaaccgcggctgcttttggaggtctttgcattggagcgctctccgtcctggcagacttcctgggagccattggttctggaactggtatcctattggccgtcactatcatctatcagtatttcgagatcttcgtcaaagaacagagcgaagtgggaagcatgggagcattgcttttctagttgtcccccaaatgggatctgattcatcacacaacttggaaggcaaatgctgtgtctgtattccaaggacttaatgtgaggcagatgtgcaccatcaagttggtttccatttaccagtggtgtcctccatcatacttttttttttcttttaccagatctctggccattttatatggagttttggacaacagcatttttttttctgagaatttttaatttccctgtttaataagcatgcctttaggttgggcatctatttaaggtcttggcaagaagaccgcacacctgcaccctggttagttaacaggcttgtacaccgagcaatggagcaatggtttatttttattttttcctttttttttcaataaaacttcttgaaaacaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MGIKFLEVIKPFCAILPEIQKPERKIQFKEKVLWTAITLFIFLVCCQIPLFGIMSSDSADPFYWMRVILASNRGTLMELGISPIVTSGLIMQLLAGAKIIEVGDTPKDRALFNGAQKLFGMIITIGQAIVYVMTGMYGDPSEMGAGICLLITIQLFVAGLIVLLLDELLQKGYGLGSGISLFIATNICETIVWKAFSPTTVNTGRGTEFEGAIIALFHLLATRTDKVRALREAFYRQNLPNLMNLIATIFVFAVVIYFQGFRVDLPIKSARYRGQYNTYPIKLFYTSNIPIILQSALVSNLYVISQMLSARFSGNLLVNLLGTWSDATTGGPARAYPVGGLCYYLSPPESFGSVLDDPVHAVVYIVFMLGSCAFFSKTWIEVSGSSAKDVAKQLKEQQMVMRGHRETSMVHELNRYIPTAAAFGGLCIGALSVLADFLGAIGSGTGILLAVTIIYQYFEIFVKEQSEVGSMGALLF
Donor tissue: tailbud