ORFeome > sephs1 – XORFeome 2.0

sephs1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis selenophosphate synthetase 1, mRNA (cDNA clone MGC:69442 IMAGE:5335855), complete cds
Gene Symbol: sephs1
Gene ID: 448749
ORF gb_acc: MG133413
ORF ID: 10923

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC074707

Library Location

Plate ID: GDExt11008
Well Location: F07

EST Sequences

Clone: MGC:69442 IMAGE:5335855
Trimmed Sequence: ATGTCTGTTCGGGAGTCTTTCAATCCAGAGAGCTATGAGCTTGATAAGAGCTTCCGCTTGACTCGCTTTGCAGAGCTGAAAGGCACTGGTTGCAAAGTTCCTCAAGATGTTTTGCAAAAACTACTGGAATCTTTGCAGGAGAATCACTTCCAGGAAGATGAACAGTTTCTAGGTGCAGTCATGCCAAGGCTTGGAATTGGCATGGATACATGTGTTATTCCATTAAGACATGGTGGCCTTTCTCTGGTTCAGACAACAGACTACATTTATCCTATTGTAGATGATCCTTACATGATGGGCCGAATAGCATGTGCAAATGTTTTAAGTGACCTGTACGCCATGGGTGTTACCGAATGTGACAACATGCTGATGCTCCTTGGTGTCAGTAATAAACTGACTGATCGGGAAAGAGACAAAGTAATGCCTCTCATTATCCAAGGATTTAAGGATGCTGCAGAAGAAGCAGGCACATCGGTTACAGGGGGCCAAACTGTGCTAAACCCATGGGTTGTTCTAGGTGGAGTTGCAACTACAGTCTGTCAGCCAAATGAATTCATTATGCCAGACAATGCTGTACCAGGTGATGTCCTTGTGCTTACCAAACCTTTGGGAACCCAGGTGGCAGTTGCTGTTCATCAGTGGCTAGATATTCCAGAAAAATGGAATAAGATTAAACTGGTGGTCACCCAAGAGGATGTGGAGTTGGCTTACCAGGAAGCAATGATGAATATGGCACGACTTAACCGAACAGCTGCTGGCCTCATGCACACATTTAATGCACATGCTGCAACAGATATAACAGGGTTTGGAATTCTAGGTCATGCACAGAACTTGGCTAAACAACAACGGAATGAAGTTTCTTTTGTTATCCATAACCTGCCTGTATTGGCCAAGATGGCTGCTGTCAGCAAGGCCTGTGGAAATATGTTTGGTCTTATGCATGGATCATGTCCTGAGACATCGGGAGGCCTGCTTATCTGTTTGCCACGGGAACAGGCAGCACGTTTTTGTGCCGAAATTAAATCCCCTAAGTATGGAGAGGGCCACCAAGCATGGATTATTGGAATCGTAGAAAAGGGCAACCGCACCGCCAGAATCATAGACAAGCCTCGAATCATTGAGGTTGCCCCTCAAGTTGCCTCTCAAAATGTAAACCCCACACCTGGTGCCACCTCTTAA
Full Trace Sequence: gtagcgattcgggactgcgggctatgtttgggaattcgggactgttgggctgtgttaggaaaagcgggactgttgggcagcatgaaagctgtgtaggggaaggaacgtgcagacaccctagcaactgaaatccttcccgaagtgtgcagctcactgacagcaggggggccggtaatccaaagtttccatgttcatgggtattctaaaagcaatggatagccggcctgcagccttacagtgtgccatatcctcatgggcttctttggggttgtagtgcatctagaattggccagtgccagtagtgcaggacttaaagcaggatctaggtttgttggagaggcgatattcattcgataagcacaagggggggattaagcaattcagtcaaaagccatgtctgttcgggagtctttcaatccagagagctatgagcttgataagagcttccgcttgactcgctttgcagagctgaaaggcactggttgcaaagttcctcaagatgttttgcaaaaactactggaatctttgcaggagaatcacttccaggaagatgaacagtttctaggtgcagtcatgccaaggcttggaattggcatggatacatgtgttattccattaagacatggtggcctttctctggttcagacaacagactacatttatcctattgtagatgatccttacatgatgggccgaatagcatgtgcaaatgttttaagtgacctgtacgccatgggtgttaccgaatgtgacaacatgctgatgctccttggtgtcagtaataaactgactgatcgggaaagagacaaagtaatgcctctcattatccaaggatttaaggatgctgcagaagaagcaggcacatcggttacagggggccaaactgtgctaaacccatgggttgttctaggtggagttgcaactacagtctgtcagccaaatgaattcattatgccagacaatgctgtaccaggtgatgtccttgtgcttaccaaacctttgggaacccaggtggcagttgctgttcatcagtggctagatattccagaaaaatggaataagattaaactggtggtcacccaagaggatgtggagttggcttaccaggaagcaatgatgaatatggcacgacttaaccgaacagctgctggcctcatgcacacatttaatgcacatgctgcaacagatataacagggtttggaattctaggtcatgcacagaacttggctaaacaacaacggaatgaagtttcttttgttatccataacctgcctgtattggccaagatggctgctgtcagcaaggcctgtggaaatatgtttggtcttatgcatggatcatgtcctgagacatcgggaggcctgcttatctgtttgccacgggaacaggcagcacgtttttgtgccgaaattaaatcccctaagtatggagagggccaccaagcatggattattggaatcgtagaaaagggcaaccgcaccgccagaatcatagacaagcctcgaatcattgaggttgcccctcaagttgcctctcaaaatgtaaaccccacacctggtgccacctcttaatctaggcttacttaactttttttttgttaatgttttttttgtttttaatagaccctattccttaccatcatgcaatttaaataattgtaaagaaaaatatatatatataaatatatatcaatgtgtccgcccatttcgagaccttgggtcagttttatgagtgggtatgatttaataggtaaaaatcagttttttttttattttttagtatttttttttcctttctgttacataaactgaagatgcacctaatctttaaggcagcttctgagttgaagaatgatattgttatctgaaaagcattgattcattttgaatctatagacacttatctcttgccgcgtaggctcttttttaaaggtgctctcactcagcacagacattgccattagtagtgtcaaataagcagttagtgtcttcatttatatatgtgtatttatcattattcgtctgacaatgttggatgcctttggaagctcatatggagaggcaataaatcagttgtgggttctggcatagaagggtgcatgattcctttttaaatttaacaattttatttttgcttgggctgccgtagcctttactcttccactaccttacattgcttagtaatgcactccttttacttgtcactgctggatatatctttaactctgcatagatcagttgtaagagtgctatctttgcttaaaaagcacttctatttaggaagatattatttcctcccgtatttacagtaccttgaaaatcgttcttatcagtagcacataaacacctttgcaatgtggataaatgtgttacagaacataactgcagttcacttgcaaaaactaagattgcctatgtcacttaaatccagtaattctaaatgtgtagacataaacacaaaacactttttaattataatcaataacttttctgttctgtggttgatagtgtttcatacatttttatattttgtatagtgattacatgcctttatatgttttctttataaatcagcaactgttaagtagttggtagccatttcctttcctactttggtgcatgagtttgtgatctattaaaacaaaaattgacattgccaacattgcagcttaaactccaaacgtggtattcaaataaatatttaattttttttattgctcttgtaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MSVRESFNPESYELDKSFRLTRFAELKGTGCKVPQDVLQKLLESLQENHFQEDEQFLGAVMPRLGIGMDTCVIPLRHGGLSLVQTTDYIYPIVDDPYMMGRIACANVLSDLYAMGVTECDNMLMLLGVSNKLTDRERDKVMPLIIQGFKDAAEEAGTSVTGGQTVLNPWVVLGGVATTVCQPNEFIMPDNAVPGDVLVLTKPLGTQVAVAVHQWLDIPEKWNKIKLVVTQEDVELAYQEAMMNMARLNRTAAGLMHTFNAHAATDITGFGILGHAQNLAKQQRNEVSFVIHNLPVLAKMAAVSKACGNMFGLMHGSCPETSGGLLICLPREQAARFCAEIKSPKYGEGHQAWIIGIVEKGNRTARIIDKPRIIEVAPQVASQNVNPTPGATS
Donor tissue: tailbud