ORFeome > serbp1 – XORFeome 2.0

serbp1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis SERPINE1 mRNA binding protein 1, mRNA (cDNA clone MGC:69561 IMAGE:5379016), complete cds
Gene Symbol: serbp1
Gene ID: 407908
ORF gb_acc: MG133425
ORF ID: 10936

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC067912

Library Location

Plate ID: GDExt11009
Well Location: C07

EST Sequences

Clone: MGC:69561 IMAGE:5379016
Trimmed Sequence: ATGCCCGGTCACTTGCAGGAAGGCTTCGGCTGCGTCGTAACCAATCGGTTCGACCAGCTATTTGACGATGAATCTGACCCCTTCGAGGTGTTGAAGGCGGCCGAGAACAAGAAGAAGGAGGGCGCAGGGGGACCGGGTCAAGGGACCGGCAAAACGGCAGCTCAGGCCGCCAAACAGCCCAAGAAGGAGTCCCAGAAAGACCGGAAGAACCCTCTGTCCGAAAAGGAGGAGAAGAGCCAGGCGCCTGTACCAATCAAGAAGGAAGCTATCAGGCGGGTTGGTCGGAGACCTGATCAGCAGCAGCAGCCGCCGCAGCAGCCACCAACACAACAGCAGCAGCAACAACAACAACAACAACAGCAGCAGCAGCAACCACCTCAGTCATCACAGGGTGAAGGAAAGCCAGTTGACAGGAGGCAGTCCGATAGGCGGCCACCCCGTGAACGCCGTTTTGAAAAACCAACTGAAGAAAAGGGAGAAGCAGGGGAATTTTCTGTTGACCGACCCATCGTGGATAGGCCCATCCGTGGTCGCGGTGGCCCTGGTGGAAGGGGTGGCCGTGGCGGTCGTGGACGTGGTTTGGGCAGGGGCGATGGCTTTGACTCTCGTGGAAAACGTGAATTTGACAGGCATAGTGGCAGTGACAGAGCTTCTTCACATTTCAGTGGCCCAAAGCATGAGGATAAACGGGGAGGAAGTGGATCACACAACTGGGGCACTGTTAAGGATGAATTAAGTGAACTGGACCAGTCTGCAGTCACTGAGGAAACTCCTGAAACTGAAGAACATCCTGCTGTTGATTCTGAAAACAAGGAAAATGAGGCTGAAGAAGTGAAGGAAGAAGGTCCTAAGGAAATGACTCTGGATGAATGGAAAGCAATGCAAGACAAAGAACGTTCAAAAGTTGAATTCAACATCCGTAAACCAAATGAAGGTGCTGATGGCCAATGGAAGAAAGGCTTTGTCCTGCATAAAGCAAAGAGTGATGAGGTTCATGCTGAGTCAGATGCCCTGGATCATCATTTCCGTAAGCCTGCAAATGACATAACTTCCCAACTTGAAATTAACTTTGGAGATCTTGGACGCCCTGGTCGTGGAGGCAGGGGAGGAAGAGGCGGCCGTGCCCGCGGCGGTAGGCCTAGTCGTGGAGGAAGAACTGACAAGTCAAATGCTTCTGCTCCTGATGTAGATGACCCCGAAGCTTTTCCAGCTTTGGCGTAA
Full Trace Sequence: ttttggcttactagcaagcgagctctaggctccaggcctcgtagaatcggaggaacatccacctcttaaggggccatcatgcccggtcacttgcaggaaggcttcggctgcgtcgtaaccaatcggttcgaccagctatttgacgatgaatctgaccccttcgaggtgttgaaggcggccgagaacaagaagaaggagggcgcagggggaccgggtcaagggaccggcaaaacggcagctcaggccgccaaacagcccaagaaggagtcccagaaagaccggaagaaccctctgtccgaaaaggaggagaagagccaggcgcctgtaccaatcaagaaggaagctatcaggcgggttggtcggagacctgatcagcagcagcagccgccgcagcagccaccaacacaacagcagcagcaacaacaacaacaacaacagcagcagcagcaaccacctcagtcatcacagggtgaaggaaagccagttgacaggaggcagtccgataggcggccaccccgtgaacgccgttttgaaaaaccaactgaagaaaagggagaagcaggggaattttctgttgaccgacccatcgtggataggcccatccgtggtcgcggtggccctggtggaaggggtggccgtggcggtcgtggacgtggtttgggcaggggcgatggctttgactctcgtggaaaacgtgaatttgacaggcatagtggcagtgacagagcttcttcacatttcagtggcccaaagcatgaggataaacggggaggaagtggatcacacaactggggcactgttaaggatgaattaagtgaactggaccagtctgcagtcactgaggaaactcctgaaactgaagaacatcctgctgttgattctgaaaacaaggaaaatgaggctgaagaagtgaaggaagaaggtcctaaggaaatgactctggatgaatggaaagcaatgcaagacaaagaacgttcaaaagttgaattcaacatccgtaaaccaaatgaaggtgctgatggccaatggaagaaaggctttgtcctgcataaagcaaagagtgatgaggttcatgctgagtcagatgccctggatcatcatttccgtaagcctgcaaatgacataacttcccaacttgaaattaactttggagatcttggacgccctggtcgtggaggcaggggaggaagaggcggccgtgcccgcggcggtaggcctagtcgtggaggaagaactgacaagtcaaatgcttctgctcctgatgtagatgaccccgaagcttttccagctttggcgtaagcttggatgacttgtccaactttggtgcccctgagggaccccttctacgaggcttgcatgcttaaggatcctaaactactacaaattaaaaaaaaaaaaaaa
Translation: MPGHLQEGFGCVVTNRFDQLFDDESDPFEVLKAAENKKKEGAGGPGQGTGKTAAQAAKQPKKESQKDRKNPLSEKEEKSQAPVPIKKEAIRRVGRRPDQQQQPPQQPPTQQQQQQQQQQQQQQQPPQSSQGEGKPVDRRQSDRRPPRERRFEKPTEEKGEAGEFSVDRPIVDRPIRGRGGPGGRGGRGGRGRGLGRGDGFDSRGKREFDRHSGSDRASSHFSGPKHEDKRGGSGSHNWGTVKDELSELDQSAVTEETPETEEHPAVDSENKENEAEEVKEEGPKEMTLDEWKAMQDKERSKVEFNIRKPNEGADGQWKKGFVLHKAKSDEVHAESDALDHHFRKPANDITSQLEINFGDLGRPGRGGRGGRGGRARGGRPSRGGRTDKSNASAPDVDDPEAFPALA
Donor tissue: tailbud