ORFeome > serpinf1 – XORFeome 2.0

serpinf1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis serine (or cysteine) proteinase inhibitor, clade F), member 1, mRNA (cDNA clone MGC:76294 IMAGE:5379531), complete cds
Gene Symbol: serpinf1
Gene ID: 394686
ORF gb_acc: MG132875
ORF ID: 10236

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC062520

Library Location

Plate ID: GDExt11003
Well Location: E05

EST Sequences

Clone: MGC:76294 IMAGE:5379531
Trimmed Sequence: ATGAAGATCTACCTGGCTTTGCTTTTTACAGGAAGTTTCCTTTCCTACACCAGCGCCCAGAATGCTGCAGATGAGGTCCCTACAGAGGTAGAAGAAGAAGATCCCTTCTACAAGAGTCCAATCAACAGGCTTGCCTCTTCTGCATCTAACTTTGGATATGACCTATATCGTATGCAAGCAAACAAAAATCCCAACAGCAATATCATTATTTCACCACTGAGCATTGCTACATCTCTGTCAAGTCTTTCCTTGGGGGGTGGACAAAGAACTGAATCATTAATCCAGCGTTCTCTATACTATGACCTTCTCAATGATCCTGAAGTCCATGCTACATATAAAGACTTGCTTGCAAGTTTTACTTCTCAAGCGAGTGGATTGAAAAGCACATGGCGAATCATGCTGGAGAGAAGGCTCAGGCTACGGATGGATTTTGTGACTCAGGTAGAGAAGTTCTATGGAAACAAGCCAAAGGTTTTGACAGGAAGCACTCGCCTGGACCTGCAGGAAGCCAACGACTTTATACAGAAGCAGACACAAGGGAAAGTGGTGAAGTTCTTCAAAGAGATTCCAACTAGTGTGAGCATTCTGCTGCTCGGAACTACTTACTTAAAAGGCCAGTGGGCGTACAAATTTAATCCTCGGGAAACTGTCCAGCGTGAATTCCACCTCGATGAACAGACATCTGTCACTGTTCCAATGATGTCATCTAAAAACATCCCCGTGAGATACGGCTTAGACTCTGATTTTAACTGCAAGATTGTTCAGCTTCCTCTCACTGGTGGGGTTAGCATCATGTTTTTCCTGCCAAACACAGTCACCCAGAACTTGACTATGATTGAAGAGGGCCTGACATCTGAGTTTGTCCATGACATAGACCAGGCACTGCAGCCTATCAACTTGGTCCTAAGCGTCCCTAAACTAAAGCTGAACTATGAAGCTGAGCTTAAGGAAGCACTGCAGGAATCAAAGCTCCAATCCCTTTTCGCCACTCCTGACTTCAGCAAAATCTCCTCAAAGCCATTAAAGCTCTCCTATGTCGTACATAAAGCCACCTTGGAATTGAACGAGGAAGGAGCAGAGACAGCGCCAAAACCAGAGGACAGCCACCGCAATTACTTTCCTTTGGAGTATCACTTAGATCATCCTTTCTTGTTTGTTCTCCGTGCCAATGACAACGGCGCTCTCCTCTTCATTGGGAAAGTTATGGACCCTAAGGGATTCTCCTTCTAA
Full Trace Sequence: gcccgggggaggtaccctgtcccaggagacagaacccgtgggtaccagcaattacccttgccaagaactgacaatgaagatctacctggctttgctttttacaggaagtttcctttcctacaccagcgcccagaatgctgcagatgaggtccctacagaggtagaagaagaagatcccttctacaagagtccaatcaacaggcttgcctcttctgcatctaactttggatatgacctatatcgtatgcaagcaaacaaaaatcccaacagcaatatcattatttcaccactgagcattgctacatctctgtcaagtctttccttggggggtggacaaagaactgaatcattaatccagcgttctctatactatgaccttctcaatgatcctgaagtccatgctacatataaagacttgcttgcaagttttacttctcaagcgagtggattgaaaagcacatggcgaatcatgctggagagaaggctcaggctacggatggattttgtgactcaggtagagaagttctatggaaacaagccaaaggttttgacaggaagcactcgcctggacctgcaggaagccaacgactttatacagaagcagacacaagggaaagtggtgaagttcttcaaagagattccaactagtgtgagcattctgctgctcggaactacttacttaaaaggccagtgggcgtacaaatttaatcctcgggaaactgtccagcgtgaattccacctcgatgaacagacatctgtcactgttccaatgatgtcatctaaaaacatccccgtgagatacggcttagactctgattttaactgcaagattgttcagcttcctctcactggtggggttagcatcatgtttttcctgccaaacacagtcacccagaacttgactatgattgaagagggcctgacatctgagtttgtccatgacatagaccaggcactgcagcctatcaacttggtcctaagcgtccctaaactaaagctgaactatgaagctgagcttaaggaagcactgcaggaatcaaagctccaatcccttttcgccactcctgacttcagcaaaatctcctcaaagccattaaagctctcctatgtcgtacataaagccaccttggaattgaacgaggaaggagcagagacagcgccaaaaccagaggacagccaccgcaattactttcctttggagtatcacttagatcatcctttcttgtttgttctccgtgccaatgacaacggcgctctcctcttcattgggaaagttatggaccctaagggattctccttctaataaatcagtgctgtgctatctccctttaatgttctgaatgacggagaagtgcaataaattgctttgcaaaatatctcaagtccctttggcagagagcaactgtagctactgtactgtagccgactccaatgccacagttgcctgtgttcaatcccactgtgttattaaatcattttccagaaaaaaaaaaaaaaaaaaaa
Translation: MKIYLALLFTGSFLSYTSAQNAADEVPTEVEEEDPFYKSPINRLASSASNFGYDLYRMQANKNPNSNIIISPLSIATSLSSLSLGGGQRTESLIQRSLYYDLLNDPEVHATYKDLLASFTSQASGLKSTWRIMLERRLRLRMDFVTQVEKFYGNKPKVLTGSTRLDLQEANDFIQKQTQGKVVKFFKEIPTSVSILLLGTTYLKGQWAYKFNPRETVQREFHLDEQTSVTVPMMSSKNIPVRYGLDSDFNCKIVQLPLTGGVSIMFFLPNTVTQNLTMIEEGLTSEFVHDIDQALQPINLVLSVPKLKLNYEAELKEALQESKLQSLFATPDFSKISSKPLKLSYVVHKATLELNEEGAETAPKPEDSHRNYFPLEYHLDHPFLFVLRANDNGALLFIGKVMDPKGFSF
Donor tissue: tailbud