ORFeome > sh3bgr – XORFeome 2.0

sh3bgr – XORFeome 2.0

General Information

Species: Xenopus tropicalis SH3 domain binding glutamic acid-rich protein, mRNA (cDNA clone MGC:75687 IMAGE:5380243), complete cds
Gene Symbol: sh3bgr
Gene ID: 394472
ORF gb_acc: MG132883
ORF ID: 10246

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC059735

Library Location

Plate ID: GDExt11003
Well Location: F03

EST Sequences

Clone: MGC:75687 IMAGE:5380243
Trimmed Sequence: ATGGTTATTAAGGTCTTTGTGGCTACCGTGGCAGGATCCACTGCGATAAAAAAGAAACAACAAGAGGTAGTAGGGTTTTTGGAGGCCAATCGCATCGACTTTGAAGAAAAGGATATTGCATGTAATGATGACAACCGGCAATGGATGAGGGATAACGTGCCCGGGGAGAAGAAACCGGAGAATGGAATACCCCTTCCTCCCCAGATTTTCAACAATGAACAGTATTGTGGGGACTTTGAATCGTTCTTTGATGCAAAAGAAGGAAATGAAATATTTGTGTTCCTGGGATTAACTCCGCCTGCAAGTAAGAAGGAACTGGAGGTACCATCTGGCCTGCAAAATGGGGAGGTTCCAGCAGAAGACAACACTGAAGTGACGGAACCGGCAGTATCGCAAAACGAGGAGCTCCCAGCAGACAACAGCACTGCGCAGGAATCGGAAGTACCATCTGATGTGCAACACGAGGAGGTTCCGCCAGAAGAAAACACTATTAGTGAAAGTCCCCCTGAGGAGGAGGAGGAAGAGGAAGAAGCTGAAGAGGAGGAGGTAGAAGAAGAAGAAGCGGAAGGAGAACAAGAATAG
Full Trace Sequence: gtgctgggactctgtctgtcgggatctgcgtgccccgcaccaaggcttctccccctcctcttcagccagaatggttattaaggtctttgtggctaccgtggcaggatccactgcgataaaaaagaaacaacaagaggtagtagggtttttggaggccaatcgcatcgactttgaagaaaaggatattgcatgtaatgatgacaaccggcaatggatgagggataacgtgcccggggagaagaaaccggagaatggaataccccttcctccccagattttcaacaatgaacagtattgtggggactttgaatcgttctttgatgcaaaagaaggaaatgaaatatttgtgttcctgggattaactccgcctgcaagtaagaaggaactggaggtaccatctggcctgcaaaatggggaggttccagcagaagacaacactgaagtgacggaaccggcagtatcgcaaaacgaggagctcccagcagacaacagcactgcgcaggaatcggaagtaccatctgatgtgcaacacgaggaggttccgccagaagaaaacactattagtgaaagtccccctgaggaggaggaggaagaggaagaagctgaagaggaggaggtagaagaagaagaagcggaaggagaacaagaatagatcacttgatatcagttctgtttcatgatatatcaaggatgcccaggcacggcagtgccacacaactgaatctgacacacacagggttccactcaattctcgggacgctgcagcattgaataaagaagacccttcccacaatgccactatctgctcctgcagggtttttccacatgggattcaatgggatctctttgcactgtcatttcccccaaggtccattacaaacaggatgctatgtatgcagtttgtaataaagttacaatttaaaaaaaaaaaaaaaa
Translation: MVIKVFVATVAGSTAIKKKQQEVVGFLEANRIDFEEKDIACNDDNRQWMRDNVPGEKKPENGIPLPPQIFNNEQYCGDFESFFDAKEGNEIFVFLGLTPPASKKELEVPSGLQNGEVPAEDNTEVTEPAVSQNEELPADNSTAQESEVPSDVQHEEVPPEENTISESPPEEEEEEEEAEEEEVEEEEAEGEQE
Donor tissue: tadpole