ORFeome > sh3bp4 – XORFeome 2.0

sh3bp4 – XORFeome 2.0

General Information

Species: Xenopus tropicalis SH3-domain binding protein 4, mRNA (cDNA clone MGC:89621 IMAGE:6995473), complete cds
Gene Symbol: sh3bp4
Gene ID: 496599
ORF gb_acc:
ORF ID: 11998

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC086304

Library Location

Plate ID: GDExt11020
Well Location: F05

EST Sequences

Clone: MGC:89621 IMAGE:6995473
Trimmed Sequence: ATGGCAGCGCAGAAGATACGATCTGCAAACACCAATGGCCTCCCACGCTGCAAGTCTGAGGGTGCCCTGATTGACTTCAGTGGGGTTCCTGACCCAAATCTAAGTGATGTCAAAGTGCTCTCTCCTAGTTCCCTGCGTGTTGACAATCCTGCATCACTGGATAATGTAAAGGAAGTTGTGGCCATCAAGGACTATTGCCCCAATAATTTCACTACTCTGAAGTTCTCCAAAGGAGAGCACTTGTATGTACTTGACACTTCTGGTGGAGAATGGTGGTATGCGCACAACACAACAGAAATGGGTTACATTCCCTCCTCTTACGTGCAGCCACTCAACTATCGAGACTCCTGCCTTAGTGACAGTGGAATGATAGATGGTCTTCTGGAGAGCGTGGATGAGGGGGTAAAGGAACTGGACCTCCTGGGAGACTGGACCGAAACCATCAGTCAGGACCCGATCAAAAAATGTCACAATAATCCCTTTTTACGGCCTTCTGTTTCAAACCCATTTCTTAACGGTCCTTTAATGCCCCAGATCCATGCTTTAGAAACTGGAAATTCTGTGGATTTACTTCTCTTTGATCCGCTGGCTCCTAGCCATGCTTTTTCCTCTGAAACCAGTACAGATGTGCTTCTAGATTTGCTCCCTAACAACACCCAAAATGAGGTAGCTGTACCGGTTAAGAGGGACAATCCATTTTTCCGGAGCAAGCGTTCCTACAGCCTCTCCGAGCTGTCTGTCCTCCAGGCAAAGTCTGAGAACCCAACTACAGGCAGCTTCTTTGCTGGCCTTAAGTCCCCAGCACCCGAGCAGTTCCAGAGTAGGGAGGACTTTAGAACTGCTTGGCTTAACCATCGCAAACTAGCCAGGTCCTGCCATGATCTGGACCTGCTTGGCCAAAATCCTGGCTGGGGTCAGACGCAGCCTGTGGAGACAAGCATAGTCTGCAGGCTGGACAGCTCGGGGGGTGCCGTTCAGCTGCCGGACACTAACATCAGCATTCATGTCCCAGAGAAACACGTGGCCTCGGGTGAAACTCAGCAAATCTCTCTTAAAGCCCTACTTGATCCACCACTGGAACTTAATAATGACAAGTGCACTACTGTCAGCCCTGTGCTGGAGATCAAACTTAGTAACATGGATGTGCAGAGTCCTCTTACCTTGGAATTAAGAATTTCTGTGGCGCTAGGGGGTAATGCTTCTGCATTGAATATGGTAGGAATAAAATGCCTGCGGAGTGATGCTAAGGAAGGGCCATACAATCCTGTGACACAGATTTATATATATGGAGATACAGTTCAAGTAAAACTAGACAACTTAGAGCCAGTCATGTATGTAGTAATGGTGGCTCAAGGACAAGGTATTGTGTCCCCTTCCTCTGTGTGGGAGTATATTAATAAAAAGGTCACTGTTGGACTGTATGGGCCCAAACACATACATCCCTCATTTAAAGCTGTTTTAGCCATATTTGGTCATGACTGTGCCCCAAAAACCCTGCTGGTCAATGAGGTAGGGCAGCAAGCCAACAACTCTGCTCCAGTGACCCTTCAGCTGTGGGGTAAGCAGCAGTTTGTGCTACCCAAGCCTCAGGATTTACAACTTTGCCTTTTTTCTAATATGACTAACTATAGAGTGGATGCTGGTGATCAGGGCAAAATGGTGCGTGGCTTCCAGCTAAAACTTGGCAAGGTCAGTAGACTTATCTTTCCAATTATTTGCCAGGAACCTGCCCAGCTCTCTGATTTCACACTAAGGGTTCAAGTGAGAGATGAAGTTGGAGGTGTTCTATCACAGTACTGTGTTCAAACCCCCCGGCCACCTCCAAAAACTGGTAACAAGTCCACTGGACCGAGAAGGTTCCTGAAGAAGAAGGAGGTAGGAAAGATTGTTCTGTCTCCCCTTGCTGTTACATGCAAATACCCAACTTTCCAAGACCGACCAGTCACCAGTCTGAAGTATGGAAAACTTCTAAAAACTGTGGTGAGGCAAAGCAAGAATCCCTATCTGCTGGAGTACAAAAAAGGTGATGTGATAGGGTTGCTGAGTGAGGAAAAGATCCGACTTAAAGGGCAGTTGTGGAACAAGGAATGGTATATTGGATATTACCAAGGAAAATTGGGACTGGTTCATGCCAAGAATGTACTTGTTGTGGGTAAAGTGAAGCCAAGCTTTTTCTCTGGTCCTGAACTGACTACAGGGCTTCTCCTGGAACAGATGTTGCGTCCTTGCAAGTTCCTGACCTATATCTATGCTTCTGTTCGAACCTTATTAATGGAGAACATTGGGAGCTGGAGATGTTTTGCAGACGCTCTGGGTTATGGAAACTTGCCCCTCTCTTACTTCTGTCGTGTAGAATTGGAGAGCGAGACCGAAAGGGTGGCCTCTGTCCTGGAGAAACTTAAAGAAGAGTGTAACAGTGAAGGCAAAGAGAAAAAATCCTTCCAAAAAGAATTGATCATGGCCTTGCTGAAAATTGACTGCCAGGGTTTGGTTGTACGGCTCATCCAGGACTTTGTTCTACTTACAACGGCGGTGGAAGTTGCCTCCCGTTGGAGAGAGCTAGCGGAGAAATTGGCAAGAGTGTCCAAGCAACAGATGGATGGTTATGAAGCACCACATCGTGACAGGAATGGAGCGTTAGACAGTGAGGCCATGTGGAAACCAGCTTATGACTTTCTCTTGACATGGAGTGCACAAATTGGCGAAAGCTACCGAGATGTCATCCAAGAGTTACACACAGGTCTAGACAAGATGCGAAGTCCAATCACCAAGCGATGGAAACATCTCACTGGAACCCTTATCCTTGTCAATTCTTTGGACATTCTTAGAGCTGCAGCCTTCAGTACTCAGGAACCAGAGGACTGCATCATCTGA
Full Trace Sequence: cggtagaggagctgagtatgatcacgccaagggctgcctggttcctctggattgcttatcttttatctgatccttggtgacaatttgagagtatgtcactgtgagtgctggtgagtctgcaaaatggcagcgcagaagatacgatctgcaaacaccaatggcctcccacgctgcaagtctgagggtgccctgattgacttcagtggggttcctgacccaaatctaagtgatgtcaaagtgctctctcctagttccctgcgtgttgacaatcctgcatcactggataatgtaaaggaagttgtggccatcaaggactattgccccaataatttcactactctgaagttctccaaaggagagcacttgtatgtacttgacacttctggtggagaatggtggtatgcgcacaacacaacagaaatgggttacattccctcctcttacgtgcagccactcaactatcgagactcctgccttagtgacagtggaatgatagatggtcttctggagagcgtggatgagggggtaaaggaactggacctcctgggagactggaccgaaaccatcagtcaggacccgatcaaaaaatgtcacaataatccctttttacggccttctgtttcaaacccatttcttaacggtcctttaatgccccagatccatgctttagaaactggaaattctgtggatttacttctctttgatccgctggctcctagccatgctttttcctctgaaaccagtacagatgtgcttctagatttgctccctaacaacacccaaaatgaggtagctgtaccggttaagagggacaatccatttttccggagcaagcgttcctacagcctctccgagctgtctgtcctccaggcaaagtctgagaacccaactacaggcagcttctttgctggccttaagtccccagcacccgagcagttccagagtagggaggactttagaactgcttggcttaaccatcgcaaactagccaggtcctgccatgatctggacctgcttggccaaaatcctggctggggtcagacgcagcctgtggagacaagcatagtctgcaggctggacagctcggggggtgccgttcagctgccggacactaacatcagcattcatgtcccagagaaacacgtggcctcgggtgaaactcagcaaatctctcttaaagccctacttgatccaccactggaacttaataatgacaagtgcactactgtcagccctgtgctggagatcaaacttagtaacatggatgtgcagagtcctcttaccttggaattaagaatttctgtggcgctagggggtaatgcttctgcattgaatatggtaggaataaaatgcctgcggagtgatgctaaggaagggccatacaatcctgtgacacagatttatatatatggagatacagttcaagtaaaactagacaacttagagccagtcatgtatgtagtaatggtggctcaaggacaaggtattgtgtccccttcctctgtgtgggagtatattaataaaaaggtcactgttggactgtatgggcccaaacacatacatccctcatttaaagctgttttagccatatttggtcatgactgtgccccaaaaaccctgctggtcaatgaggtagggcagcaagccaacaactctgctccagtgacccttcagctgtggggtaagcagcagtttgtgctacccaagcctcaggatttacaactttgccttttttctaatatgactaactatagagtggatgctggtgatcagggcaaaatggtgcgtggcttccagctaaaacttggcaaggtcagtagacttatctttccaattatttgccaggaacctgcccagctctctgatttcacactaagggttcaagtgagagatgaagttggaggtgttctatcacagtactgtgttcaaaccccccggccacctccaaaaactggtaacaagtccactggaccgagaaggttcctgaagaagaaggaggtaggaaagattgttctgtctccccttgctgttacatgcaaatacccaactttccaagaccgaccagtcaccagtctgaagtatggaaaacttctaaaaactgtggtgaggcaaagcaagaatccctatctgctggagtacaaaaaaggtgatgtgatagggttgctgagtgaggaaaagatccgacttaaagggcagttgtggaacaaggaatggtatattggatattaccaaggaaaattgggactggttcatgccaagaatgtacttgttgtgggtaaagtgaagccaagctttttctctggtcctgaactgactacagggcttctcctggaacagatgttgcgtccttgcaagttcctgacctatatctatgcttctgttcgaaccttattaatggagaacattgggagctggagatgttttgcagacgctctgggttatggaaacttgcccctctcttacttctgtcgtgtagaattggagagcgagaccgaaagggtggcctctgtcctggagaaacttaaagaagagtgtaacagtgaaggcaaagagaaaaaatccttccaaaaagaattgatcatggccttgctgaaaattgactgccagggtttggttgtacggctcatccaggactttgttctacttacaacggcggtggaagttgcctcccgttggagagagctagcggagaaattggcaagagtgtccaagcaacagatggatggttatgaagcaccacatcgtgacaggaatggagcgttagacagtgaggccatgtggaaaccagcttatgactttctcttgacatggagtgcacaaattggcgaaagctaccgagatgtcatccaagagttacacacaggtctagacaagatgcgaagtccaatcaccaagcgatggaaacatctcactggaacccttatccttgtcaattctttggacattcttagagctgcagccttcagtactcaggaaccagaggactgcatcatctgagtactaaaaacagagacaggaccctgtggacccgccctggtgtatttgctgctgcacaagtgactttaaggactgagattttaccagcttgtaaaagatttagcttttgactagctaaagggatttatccaacttgcaaaggagtaagaacatatcaaaatagcatgactattcaaccagaaatagatctgcacactttgatacatttagctgctggcaaagggcctgcactaaaaaaaaatcaagtatttagacaaatcttagcagttttatgcctggcgtgtatatagtgtaaagtaatgtggacatatgccaaaggcacaagattgcaaatgacctgcagctttgatctctagatgcttgacaagcacaaaggcattaatttggattcttttctaccgaatgtctttgtacctgaaccttttgacttgcttagactttaaagaagaaccaggaggctaaatacctagtgtgcatagtattgtgcaatgggttcacagagactttacctgattttgttatccgttatttttttaatttatctcttctgctgacaataaaagagatgtacatatttatataaatacaggagcccttctactgactgcatcttcagaacgaacttctcctagttatttctggagcaataaaaagttaagggaggttatcactacactttcagtgtaacaggggacacaatggaggtaatgaaagcctacagaactgtaaacatgtgaaaacagctttgtttctctctaaggcaataacactttttgcctcaggattgtgtaggacgctggtacttcctgtgccttaaacttatagtgctggtgacacactcactatttgagtgagaatgacttcctgtgttccccagctgagcacaacattccatgatattctgtagaacccattctttctgctgtgctctccttataggttagaacagatttctcctaatttcctgcagtgacaatcagggaaaggcgttgtggtgtctcttgtcactggatgtttttatcggtttctttatccttgtttttctttctgaccgatttctaactacctcgccttcattcaccagaacagtctaataaacttctatggtcacagaaccaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MAAQKIRSANTNGLPRCKSEGALIDFSGVPDPNLSDVKVLSPSSLRVDNPASLDNVKEVVAIKDYCPNNFTTLKFSKGEHLYVLDTSGGEWWYAHNTTEMGYIPSSYVQPLNYRDSCLSDSGMIDGLLESVDEGVKELDLLGDWTETISQDPIKKCHNNPFLRPSVSNPFLNGPLMPQIHALETGNSVDLLLFDPLAPSHAFSSETSTDVLLDLLPNNTQNEVAVPVKRDNPFFRSKRSYSLSELSVLQAKSENPTTGSFFAGLKSPAPEQFQSREDFRTAWLNHRKLARSCHDLDLLGQNPGWGQTQPVETSIVCRLDSSGGAVQLPDTNISIHVPEKHVASGETQQISLKALLDPPLELNNDKCTTVSPVLEIKLSNMDVQSPLTLELRISVALGGNASALNMVGIKCLRSDAKEGPYNPVTQIYIYGDTVQVKLDNLEPVMYVVMVAQGQGIVSPSSVWEYINKKVTVGLYGPKHIHPSFKAVLAIFGHDCAPKTLLVNEVGQQANNSAPVTLQLWGKQQFVLPKPQDLQLCLFSNMTNYRVDAGDQGKMVRGFQLKLGKVSRLIFPIICQEPAQLSDFTLRVQVRDEVGGVLSQYCVQTPRPPPKTGNKSTGPRRFLKKKEVGKIVLSPLAVTCKYPTFQDRPVTSLKYGKLLKTVVRQSKNPYLLEYKKGDVIGLLSEEKIRLKGQLWNKEWYIGYYQGKLGLVHAKNVLVVGKVKPSFFSGPELTTGLLLEQMLRPCKFLTYIYASVRTLLMENIGSWRCFADALGYGNLPLSYFCRVELESETERVASVLEKLKEECNSEGKEKKSFQKELIMALLKIDCQGLVVRLIQDFVLLTTAVEVASRWRELAEKLARVSKQQMDGYEAPHRDRNGALDSEAMWKPAYDFLLTWSAQIGESYRDVIQELHTGLDKMRSPITKRWKHLTGTLILVNSLDILRAAAFSTQEPEDCII
Donor tissue: neurula