ORFeome > sh3bp5 – XORFeome 2.0

sh3bp5 – XORFeome 2.0

General Information

Species: Xenopus tropicalis SH3-domain binding protein 5 (BTK-associated), mRNA (cDNA clone MGC:75731 IMAGE:5381113), complete cds
Gene Symbol: sh3bp5
Gene ID: 394821
ORF gb_acc: MG132948
ORF ID: 10322

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC063334

Library Location

Plate ID: GDExt11003
Well Location: D07

EST Sequences

Clone: MGC:75731 IMAGE:5381113
Trimmed Sequence: ATGGGGCAGGAGAATGATCAGCTGAAGGAGGAAGAGGAGGAAGTGGACCCCAGGATTCAGGGAGAACTAGAGAAGCTTAATCAGTCCACTGATGATATAAACCGAAGAGAGATCGAACTGGAGGATGCCAGACAGAAGTTCCGCTCCGTACTAACTGAAGCTACCCTGAAACTCGATGAGATGGTCAAGAAGATTGGGAAAGCTGTGGAGGATTCTAAACCTTACTGGGAAGCCCGAAAAGTTGCCAGACAGGCCCAGCTAGAAGCACAGAAAGCCACCCAGGACTTCCAGCGTGCCACAGAAGTTCTGCGGGCAGCCAAGGAAACAATATCTCTGGCAGAGCAGAGGCTGCTGGAAGATGACAAACGCCAGTTTGATTCAGCTTGGCAGGAAATGCTGAACCATGCCACACAGCGGGTGATGGAAGAGGAACAGAAGAAGACGCGCAGTGAGCTGGTACATAAGGAGACGGCTGCTAAATACAATGCAGCCATGGGCAGGATGAAGCAGCTGGAGAAGAAACTAAAGAGAACAATCAACAAATCAAAGCCGTATTTTGAACTCAAGGCAAAGTATTACCTACAGCTTGAGCAACTTAAAAAAACAGTGGATGAACTCCAAGCCAAACTCTCTCTAGCAAAGGGAGAATATAAGACTGCCCTCAAAAACCTAGAGATGATCTCTGATGAGATTCATGAAAGACGCAGAACATCGGCTATGGGCCCCAGGGGGAGAGGAGTAGGCTCTGAAGGCAATAATTCACTTGAAGACCTCTCAGCTTGCAAACTGGACTCAGATGCTATATCCATGACATCAGAGGTGTTTGATGAGGACAACCTCAGTAGCTTGGTCTCTGAAGAAGATTCTGAAACCCAGTCTCTGTCTAGCTTTAGCTCTGGCCCAACCAGCCCTTCTGAGATTCCAAGTTCATTTCCTAGTGCCCCTCGACCCGGAAGCCTGGAATTATCAAGCCCTTTGTCTCTTTCCGACTTTGGTTTGATTTCACCAGTACTAGGCCCTCGAAGTGAATGCAGTGGGGCTTCCTCCCCGGAGTGTGATCTAGAAAGAGGAAACAGAGCAGAAGGATCAGAGAATGCAGCCCAGGACAGAATAAACAATAATAACAGTAAAAGCAATAGCAGGAAAGCCATGGCATTGCCAGTCCTGGACAACAAGATGAAGCAGCTCTCATTGGAATGTACAAAGACTGGAAATGGCACAAACACAGAGAGGAAGAAATACAGCCGTTCCCAGTCTTTAGCTTCTACCCTGTTGGTCAATGCTGTGTGA
Full Trace Sequence: cggcgggccggctatggaggctattgagggagcgccatgcaggggggcccgctgaccagcagcccagtgtaggtcaggcagttcccaggcacacagctgctgccgctgcagatacacattcacatgaagcaaaatggaaacaatgctaataaagaacatggggcaggagaatgatcagctgaaggaggaagaggaggaagtggaccccaggattcagggagaactagagaagcttaatcagtccactgatgatataaaccgaagagagatcgaactggaggatgccagacagaagttccgctccgtactaactgaagctaccctgaaactcgatgagatggtcaagaagattgggaaagctgtggaggattctaaaccttactgggaagcccgaaaagttgccagacaggcccagctagaagcacagaaagccacccaggacttccagcgtgccacagaagttctgcgggcagccaaggaaacaatatctctggcagagcagaggctgctggaagatgacaaacgccagtttgattcagcttggcaggaaatgctgaaccatgccacacagcgggtgatggaagaggaacagaagaagacgcgcagtgagctggtacataaggagacggctgctaaatacaatgcagccatgggcaggatgaagcagctggagaagaaactaaagagaacaatcaacaaatcaaagccgtattttgaactcaaggcaaagtattacctacagcttgagcaacttaaaaaaacagtggatgaactccaagccaaactctctctagcaaagggagaatataagactgccctcaaaaacctagagatgatctctgatgagattcatgaaagacgcagaacatcggctatgggccccagggggagaggagtaggctctgaaggcaataattcacttgaagacctctcagcttgcaaactggactcagatgctatatccatgacatcagaggtgtttgatgaggacaacctcagtagcttggtctctgaagaagattctgaaacccagtctctgtctagctttagctctggcccaaccagcccttctgagattccaagttcatttcctagtgcccctcgacccggaagcctggaattatcaagccctttgtctctttccgactttggtttgatttcaccagtactaggccctcgaagtgaatgcagtggggcttcctccccggagtgtgatctagaaagaggaaacagagcagaaggatcagagaatgcagcccaggacagaataaacaataataacagtaaaagcaatagcaggaaagccatggcattgccagtcctggacaacaagatgaagcagctctcattggaatgtacaaagactggaaatggcacaaacacagagaggaagaaatacagccgttcccagtctttagcttctaccctgttggtcaatgctgtgtgagcatattaatataagagcaggaatcctgtgccaacaaccttctttcattccatgcagactttggtagactgctgggacattggctctactcattgggagattagcatgagacctctataggaagtacaggtggcttttttcagcaggctgcctttttgccttttacccagtgtgtacatttaagtgtgtatcctgtgtttagggaggaatagtccgcatagccatcaccagagcaataaattcaatgaactttctgtgccaaaaaaaatgtctggattctgaagtgaacttccgtgatgaggtgtttttgttccttgtctttttaggtaggactgcaatctcttcttgtctactggagagtcagcattgatgtattagcaaatcaacacccatcacatctcatgtttatgtagtagaacaactgttttcgcattttctatgctgttaaaacagtgccaagtaacagtcatttgcacaatgggacattaaatgatacctgcacagattcatttgatgtgatccaggcattacgtatgccttcctttatctgtctagccccattcattcctccacttggcctttggtccatcatcttgaccacttaatagcaatttgctccgatgtaataaagcctttggaaagtaatcctctttgtgtctaaccactaactttccaagccaaatgccatccagtatttgcactgctttgttcatcagtgctccatggtgaagaaaggcctcagtggcaaagatgccacccttttcctaaactcctacgctggagagtatttgataccaggacattgatatatgcatgccatagacaagtgtatgcagatcaggattgataatgtatttcatcactagatatataccaattatgaggatggatggactgttaagctgcattcattcagctatggaaagttccatatgattttgcgatcttgtttatgttttatactatacctgtgatgtcaaacttgcaaaccacccacccaataaggctttttgaaaaaaaaaaaaaagccagaaaacagtgagttagacatctctgttttaaacaaccttcttacagcttgtataaatgtagaaatgtaatggatgaatgtaatagatttctaccatgtgccattgggaaatgtcaataattacttggccaaatagccagagtaatctcacttaaatgcacttctgatgtgattgggctgtccttgagggaacatggggaaggttatagatctggggtggagctgattccatgaaactatccatgacatgttaactgccctacccagcttcactgtaccctttctctgaattccccccttacttttgcaggcgagaggacatgattacagagtattaaaaccgtccatactgtatagacagcctaggattttgggcactgaggctggtttaactataggcaatgatactgttagagcaaggcagtggagtctaagctgctggtttgtagtaacagggtttgcaagtctcttttctatgttattctgaagtttttgctaggggaatttagtattattggaatatggtgactcccactgctgctgtctttgtgttcattccacagcttgtgtgttttctgcagccaaataaagtgtgtttcatgcaagttaaaaaaaaaaaaaaaaaaaaaa
Translation: MGQENDQLKEEEEEVDPRIQGELEKLNQSTDDINRREIELEDARQKFRSVLTEATLKLDEMVKKIGKAVEDSKPYWEARKVARQAQLEAQKATQDFQRATEVLRAAKETISLAEQRLLEDDKRQFDSAWQEMLNHATQRVMEEEQKKTRSELVHKETAAKYNAAMGRMKQLEKKLKRTINKSKPYFELKAKYYLQLEQLKKTVDELQAKLSLAKGEYKTALKNLEMISDEIHERRRTSAMGPRGRGVGSEGNNSLEDLSACKLDSDAISMTSEVFDEDNLSSLVSEEDSETQSLSSFSSGPTSPSEIPSSFPSAPRPGSLELSSPLSLSDFGLISPVLGPRSECSGASSPECDLERGNRAEGSENAAQDRINNNNSKSNSRKAMALPVLDNKMKQLSLECTKTGNGTNTERKKYSRSQSLASTLLVNAV
Donor tissue: tadpole