ORFeome > slc18a1 – XORFeome 2.0

slc18a1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis slc18a1 protein, mRNA (cDNA clone MGC:69192 IMAGE:5307285), complete cds
Gene Symbol: slc18a1
Gene ID: 594935
ORF gb_acc: MG134268
ORF ID: 11934

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC090568

Library Location

Plate ID: GDExt11019
Well Location: D02

EST Sequences

Clone: MGC:69192 IMAGE:5307285
Trimmed Sequence: ATGGCAAGATGTTCCCCATGTTGTCAGTGGTTGAAGAAAACATGGGAGTCCCGGGCTCCGATCCTGTTGGTGGTTGCAGTGGTTATGTTTGTGGATTGCATTCTGTTCACTATTATTGCTCCAATTGCCCCAGCTTTACTTTATGACATTGAGTATGGGAGAGGAAACAGAACATTTAAGAACTCCTCCGGTCAGTATCCTGTCTCCAACTATGATTCCATTTTTAATCTTTCACACCTTGAAGACTCAAGAAAAGGACCTTACCATGACCAGATCATTAATATTACTGAGAGTCCTGGAGATAAAAAGAACTGCTACGAGGGGAAGGACTTTTTAAACGAAGAGAATGTGCGAGTGGGTCTTCTCCTTGCAATTAAAGCCTTTCTTCAGCTTCTGTTTAACCCCATTGTGGGTAAACTCGTTACCAGGATTGGATATGATGCCCCAATGTTTTTTGGTTTCGTAATTGTGGTCGTCTCCACTCTTTTGTTTGCATTTGCCAACTCATATGCCCTTCTTTGTGTGGCCAGGGGGTTCCAGGGAATTGGATCATCCTTCACTATGGTGCCGGCTCTGGGCACACTGGCACAAGTGTTTCCGGATGATGTCGAAAGAGGAAAAGCCATGGGTTTAGCCATGAGTGGTGTTGCCATTGGGGTGCTCGCTGGGCCTCCCTTTGGTTCTGCCATGTATGAATTTGTTGGAAAATCTTCTCCGTTTCTGGTTATAGCTGCATTAGCTCTTATTGATGGAGCACTGCAGTGTTGTGTACTTAAGCCTACAAAGTTTTCCCCATTGAGTGTACCTGAAACACCCTACAGGGTTCTCCTCACGGATCCATACATTGTGGTGGCTGCAGTGGGTCTCTGTATTTGTAATTTTTCCTTTGGCATAATGGAACCAACTATACCAATAAGAATGATGGAAACCATGTGCTCCCCTCCCTATCAGCTTGGACTGGCTTTTCTTCCCTGTATGCTTGCATATTTCATTTGCCTCAATCTTTTCGCGGGGTTTGCTCATAAAATTGGGAGGTGGCTATGCATTATGATTGGAATGATGGCTCTAGGAATCAGTGTCCTGTGTTTGCCTTTAGCAAGAAATATTTTTGGACTGATTGCACCTCAAGCTGGAGTGGGAATTGGCTTTGGATTATTTGAGACATCAATGTTTCCGATGATGGCCCACCTGGTCGATATACGGCACACTTCAAACTATGGGGCCATCTATGCCATCTCCGATATTGCTCTGTGTATTGGTTATGCGCTGGGCCCGTCATGTGGAGGCGCCATTGCCAAGGCCATTGGATTTACCTGGTTAATGGTGATATTAGGTATAATAAACCTTCTTTATGCCCCTCTCTTCATTCTGCTGCGCAACCCACCAGCCTGTACTCAGCCAAGAGGAGACGCAAGAGCAGGAAGAATCAAAACCTCTCCCCACCAAAGTGGCTGA
Full Trace Sequence: cctgacagggttacatgatgaaatccatttggctgcacatctcatgctaactggatcgggacacagaaattcaccaacattagtacaggaggagttatcgggtccataacaaaatggcaagatgttccccatgttgtcagtggttgaagaaaacatgggagtcccgggctccgatcctgttggtggttgcagtggttatgtttgtggattgcattctgttcactattattgctccaattgccccagctttactttatgacattgagtatgggagaggaaacagaacatttaagaactcctccggtcagtatcctgtctccaactatgattccatttttaatctttcacaccttgaagactcaagaaaaggaccttaccatgaccagatcattaatattactgagagtcctggagataaaaagaactgctacgaggggaaggactttttaaacgaagagaatgtgcgagtgggtcttctccttgcaattaaagcctttcttcagcttctgtttaaccccattgtgggtaaactcgttaccaggattggatatgatgccccaatgttttttggtttcgtaattgtggtcgtctccactcttttgtttgcatttgccaactcatatgcccttctttgtgtggccagggggttccagggaattggatcatccttcactatggtgccggctctgggcacactggcacaagtgtttccggatgatgtcgaaagaggaaaagccatgggtttagccatgagtggtgttgccattggggtgctcgctgggcctccctttggttctgccatgtatgaatttgttggaaaatcttctccgtttctggttatagctgcattagctcttattgatggagcactgcagtgttgtgtacttaagcctacaaagttttccccattgagtgtacctgaaacaccctacagggttctcctcacggatccatacattgtggtggctgcagtgggtctctgtatttgtaatttttcctttggcataatggaaccaactataccaataagaatgatggaaaccatgtgctcccctccctatcagcttggactggcttttcttccctgtatgcttgcatatttcatttgcctcaatcttttcgcggggtttgctcataaaattgggaggtggctatgcattatgattggaatgatggctctaggaatcagtgtcctgtgtttgcctttagcaagaaatatttttggactgattgcacctcaagctggagtgggaattggctttggattatttgagacatcaatgtttccgatgatggcccacctggtcgatatacggcacacttcaaactatggggccatctatgccatctccgatattgctctgtgtattggttatgcgctgggcccgtcatgtggaggcgccattgccaaggccattggatttacctggttaatggtgatattaggtataataaaccttctttatgcccctctcttcattctgctgcgcaacccaccagcctgtactcagccaagaggagacgcaagagcaggaagaatcaaaacctctccccaccaaagtggctgatagtcatgagtgacaaggagattgcccgtggctccaggaataacaagaacaaagtcttctggccttagtcagattaaagcaaaatgataggatcacagcttgtcagtttttttgtaccactgacaacaggttaaaatggacacctattaggggaatttactaaatactgcactggcacattcagggccctcactgtttctgctgggcctgtgtatatgcagtctgcctgctgagaagaaggaatagacatgctttccccagtttggtgggaaacagaacaggggatatgaattgtcttacaagggatacatgtttaataagctatttggaaaataaaggtttggtaataaatttagaagtaattcagcaggaattcacagagattcattctgggatatgtgtgtaagagtttcagagacttccttcctctatgctgtgattctgataggaaacaaatagaatatccattgttcttagaattatttttaaaaatgtgatttatttgcttaaaatggaatctatgggagacggccttgccataattcagcactttctccataatgggtttctggataatggattccatacctgcatatatatttagacatcagatttttttccggcatttgagaacattgcaggaaaaaacaatggaaaaaaaatcatgaaaagaaaatagaatatttattgttctggtctgatacaggaacatatgcaacccctcatgtcttcctcaatattcttgtataaggtaaacagtttatatgtatttatgctgctttccagatgcctccggtcacgaaaatttgaaattaagtttttttacaaatatgaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MARCSPCCQWLKKTWESRAPILLVVAVVMFVDCILFTIIAPIAPALLYDIEYGRGNRTFKNSSGQYPVSNYDSIFNLSHLEDSRKGPYHDQIINITESPGDKKNCYEGKDFLNEENVRVGLLLAIKAFLQLLFNPIVGKLVTRIGYDAPMFFGFVIVVVSTLLFAFANSYALLCVARGFQGIGSSFTMVPALGTLAQVFPDDVERGKAMGLAMSGVAIGVLAGPPFGSAMYEFVGKSSPFLVIAALALIDGALQCCVLKPTKFSPLSVPETPYRVLLTDPYIVVAAVGLCICNFSFGIMEPTIPIRMMETMCSPPYQLGLAFLPCMLAYFICLNLFAGFAHKIGRWLCIMIGMMALGISVLCLPLARNIFGLIAPQAGVGIGFGLFETSMFPMMAHLVDIRHTSNYGAIYAISDIALCIGYALGPSCGGAIAKAIGFTWLMVILGIINLLYAPLFILLRNPPACTQPRGDARAGRIKTSPHQSG
Donor tissue: gastrula