ORFeome > slc31a1 – XORFeome 2.0

slc31a1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis solute carrier family 31 (copper transporters), member 1, mRNA (cDNA clone MGC:69410 IMAGE:5335501), complete cds
Gene Symbol: slc31a1
Gene ID: 407919
ORF gb_acc: MG133330
ORF ID: 10830

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC067952

Library Location

Plate ID: GDExt11007
Well Location: E11

EST Sequences

Clone: MGC:69410 IMAGE:5335501
Trimmed Sequence: ATGGATCACTCCCACCACACGGTAACTACCAGCGACCCCCACGGGGGCCACCACCACCCAACCACATCCGGGAACCACGGCGACCACGGGGGCAGCATGCACATGATGCAAATGACCTTTTACTTTGGATACGAGAATGTGGAGGTGCTGTTCACCGGGTTGGTCATTAACTCTGCAGGAGAAATGGCGGGTGCGTTCGTGGCGGTGTTCCTGCTGGCGCTGCTGTACGAGGGGCTGAAGATCTCGCGGGAGGCCTTACTCAGGAAGTCACAAGTCAGTATTCGCTATAACTCCATGCCGGTGCCGGGGCCCAATGGGACCATACTGATGGAGACCCACAAAACAGTAGGGCAGCGGATGCTGAGTGTGCCCCACCTGCTGCAGACCCTACTGCACATAATCCAGGTAGTGGTGAGCTACTTCCTGATGCTGATCTTCATGACGTACAACGCCTACCTGTGCATCGCGGTGGCCGCCGGGGCCGGGACGGGCTACTTCCTGTTCAGCTGGAAGAAGGCGGTGGTGGTGGACATCACGGAACATTGCCATTAA
Full Trace Sequence: gaagcggtctgaggtgacagtacgcggagtgacctctggttccgggattggaactacggatcctgcggagggtgagtctgactgtcgcttcggcccaacatggatcactcccaccacacggtaactaccagcgacccccacgggggccaccaccacccaaccacatccgggaaccacggcgaccacgggggcagcatgcacatgatgcaaatgaccttttactttggatacgagaatgtggaggtgctgttcaccgggttggtcattaactctgcaggagaaatggcgggtgcgttcgtggcggtgttcctgctggcgctgctgtacgaggggctgaagatctcgcgggaggccttactcaggaagtcacaagtcagtattcgctataactccatgccggtgccggggcccaatgggaccatactgatggagacccacaaaacagtagggcagcggatgctgagtgtgccccacctgctgcagaccctactgcacataatccaggtagtggtgagctacttcctgatgctgatcttcatgacgtacaacgcctacctgtgcatcgcggtggccgccggggccgggacgggctacttcctgttcagctggaagaaggcggtggtggtggacatcacggaacattgccattaacgagcgctcgttagggaaggagctctgtgccccgcctccatcggcattcctagatgttggtaccgggggtattggggtaaccctacatacagagtgcctttatttgcctctagcgggggtcagtgacactttcctttgaggataaagtggatgaaccacatgaccatgtagcctcacccccttccctcctcttcctctgcgccaatcatacggtggctcctggaagacacgccctacagtgtcactgcagccaatcaagtctttgtctcatctgaagcctggcctaagcaccaccactctcattggccggtctgtacgtcatgtgaccttccagccagccctacgacttcacatgttcgattcccgttatccccacatccgatttctacggaactttccatggaagtataacgagtccgtgtggcagtaaagccgatgttcaactgtaacattgtgtgtctgtttcatacactcgccaggttaacttgccctttaatcgtccctatgatagtctggagctttaagccccgccccctcggtaccccaaacggcagaagttctaatcccatcccttagcgaccaattataacccaatatttagatgtgccgccaaggggcggagtcaaggcgatcacatgttcatgttaattgcagaattattcgcaatgttaccgatttcatttttttttatttaagatttttttttttatggttttatctgcatcatgtgacctttttataaattgcctttatttccaatagtgaaaaataataataattattgaaccttttaataaacgagaatctgcagtcggaaaaaaaaaaaaaaaaaa
Translation: MDHSHHTVTTSDPHGGHHHPTTSGNHGDHGGSMHMMQMTFYFGYENVEVLFTGLVINSAGEMAGAFVAVFLLALLYEGLKISREALLRKSQVSIRYNSMPVPGPNGTILMETHKTVGQRMLSVPHLLQTLLHIIQVVVSYFLMLIFMTYNAYLCIAVAAGAGTGYFLFSWKKAVVVDITEHCH
Donor tissue: tailbud