ORFeome > slc38a3 – XORFeome 2.0

slc38a3 – XORFeome 2.0

General Information

Species: Xenopus tropicalis solute carrier family 38, member 3, mRNA (cDNA clone MGC:79642 IMAGE:6980150), complete cds
Gene Symbol: slc38a3
Gene ID: 496461
ORF gb_acc: MG134300
ORF ID: 11972

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC084176

Library Location

Plate ID: GDExt11019
Well Location: G04

EST Sequences

Clone: MGC:79642 IMAGE:6980150
Trimmed Sequence: ATGGAGTTGGATAATTTAGGGGATGGAGAAGATGCCCACATGCTGAATGGCAGTGTGTCGGAGAGCCTGAATACCGAGAGACTAAACATGGAGGATGGGGATGAAGCGGAAGAAGCAGCTCTTGAAGAAAGGGAGAAGTTTCTGTCGCATGTGGTTCCCCAGAAATCCAACTTTACCGATTTCGAAGGGAAGACATCATTTGGCATGTCCGTGTTTAACCTGAGCAATGCCATTATGGGCAGCGGGATTCTGGGCCTGGCCTATGCCATGTCTAACACTGGCATCATTCTCTTTGTATTCCTCCTGATCTCCATTGCTCTACTCTCTTGTTACTCCATCCACCTTCTTCTCAAGTGCTCTGGAGTTGTGGGGATTCGTGCTTATGAGCAGCTGGGACTCCGAGCTTTTGGCACTGCAGGGAAGATTCTGGCAGCAGTGATTATAACAATGCACAATGTGGGAGCAATGTCCAGTTATTTGTACATCATCAAATATGAACTGCCGCTTGTTATCCAAACCTTCATGGGCCTGACCAGTAATTCCGGGGCCTGGTATATGAATGGCAACTACCTCATCGTTATAGTCAGCATCTTAGTCATTCTTCCCCTGGCGCTTATGAAACATCTAGGATACCTGGGATACACCAGTGGTTTCTCCCTCACGTGTATGGTCTTCTTTTTGTGTTCGGTTATATACAAATACTCTGTAATTCCTTGCCCGCTGAACAGCACCGTAGCAGAAAACCACACCATCTACACCAACGGTCAGAAACTGGAGGAGGAAGACGTATGCACAGCTAAGCTACTGACAGTCAATTCTCAGACAGCTTACTCCATCCCAATTGTGGCGTTTGCCTTTGTGTGCCACCCTGAGGTCCTGCCCATATACACAGAGCTACGCAGGGCTTCCAAGTCACGGATGCAGAATGTGGCCAATGTTTCCATCTTTGCCATGTTTATCATGTACCTGCTCACTGCCATCTTCGGCTACTTAACCTTTTACGGTAACGTGGAATCTGAGATGCTACACACTTACAACAAGGTGGATCCCCTGGACAAGCTGATGCTCTGCGTGCGTCTGGCTGTGTTGGTGGCTGTGACACTCACTGTACCGGTGGTTCTCTTCCCAATCCGCAGAGCTATCCAGCAGCTTCTCTGTCCAGGACAGGAGTTCAAGTGGTGGCGTCATATCCTTATAGCTGTGGTGCTGCTTATTGCTGTCAATATTCTCGTCATCTTCGTCCCCAACATCAAGGACATTTTTGGCGTTATCGGAGCCACATCAGCCCCGAGCCTTATTTTCATCCTGCCGAGCATTTTCTACATCCGCATCGTCCCCAATGAGAAGGAGCCACTCCGGTCCCGTCCCAAGATACAGGCTGCCTTGTTTGCTTCTCTGGGATTCATTTTCATGATAATGAGCCTGAGTTTCATCATAGTCGACTGGGTGACGACAGGAAAGAGCAACGTTGGGGGGCACTAA
Full Trace Sequence: cagggaggaaatctcccctggactggagggcccccctcttgtgatgagcttggccgtcataatctctaccctgctctctccggtaccatcctactgtaaccagcagctcacagaacccatttggcgcccaccatggagttggataatttaggggatggagaagatgcccacatgctgaatggcagtgtgtcggagagcctgaataccgagagactaaacatggaggatggggatgaagcggaagaagcagctcttgaagaaagggagaagtttctgtcgcatgtggttccccagaaatccaactttaccgatttcgaagggaagacatcatttggcatgtccgtgtttaacctgagcaatgccattatgggcagcgggattctgggcctggcctatgccatgtctaacactggcatcattctctttgtattcctcctgatctccattgctctactctcttgttactccatccaccttcttctcaagtgctctggagttgtggggattcgtgcttatgagcagctgggactccgagcttttggcactgcagggaagattctggcagcagtgattataacaatgcacaatgtgggagcaatgtccagttatttgtacatcatcaaatatgaactgccgcttgttatccaaaccttcatgggcctgaccagtaattccggggcctggtatatgaatggcaactacctcatcgttatagtcagcatcttagtcattcttcccctggcgcttatgaaacatctaggatacctgggatacaccagtggtttctccctcacgtgtatggtcttctttttgtgttcggttatatacaaatactctgtaattccttgcccgctgaacagcaccgtagcagaaaaccacaccatctacaccaacggtcagaaactggaggaggaagacgtatgcacagctaagctactgacagtcaattctcagacagcttactccatcccaattgtggcgtttgcctttgtgtgccaccctgaggtcctgcccatatacacagagctacgcagggcttccaagtcacggatgcagaatgtggccaatgtttccatctttgccatgtttatcatgtacctgctcactgccatcttcggctacttaaccttttacggtaacgtggaatctgagatgctacacacttacaacaaggtggatcccctggacaagctgatgctctgcgtgcgtctggctgtgttggtggctgtgacactcactgtaccggtggttctcttcccaatccgcagagctatccagcagcttctctgtccaggacaggagttcaagtggtggcgtcatatccttatagctgtggtgctgcttattgctgtcaatattctcgtcatcttcgtccccaacatcaaggacatttttggcgttatcggagccacatcagccccgagccttattttcatcctgccgagcattttctacatccgcatcgtccccaatgagaaggagccactccggtcccgtcccaagatacaggctgccttgtttgcttctctgggattcattttcatgataatgagcctgagtttcatcatagtcgactgggtgacgacaggaaagagcaacgttggggggcactaaccggaccctccctcctctccctttggatatgaacattggggcagctcccctagggacccctatatccaaagtgatgcagcagcacggcctctgcaactggaaggaacaaatccttaatcaaacttgagaaccaaaggacctgaagcaactaaatgaggagagagggaccttctcatgaaaccgcacaagattaaaccataggtgcccaaagtgactctaccatgccgggtgtggagtcacactcatgctgccctctcacttgaccctcagccactacagagatgcaacactctttattccttttccacgggccccatctgtctgtccttggagaaagcactaggttggacatgaaccccaagcacctgtgcgttatttccctcacctctgcaacttgagtgttaccaaaacttcattgaatcacagtgtatctacctcactatgccccctccaagagggggtaagagtgtgtgctgcactcagggggatagttaagcactctctttgagaggacactacagcagcaacacaataaaagccatatcagctacccctacacgtcactaacagccttttcctttctaccaatgcaagtatgaatgtgctggtgtgccaggtggctcgctgcacccctataccccgcagctggggatacagtgaaacaacactagttgtgaaggcagcagttccttttttataattaactgttacacatctgtagccacacagctatagtatccctagcctacacttggctcctagttcagctggcccccatactgtgggaagctggcggcttcagatcttccctctcctcctgatcactgtgaattcagtgggaattccaatgctttggtgctggattgtgccaactagcgcagcgccccccagtgttacacactccaccaacaggctatgctgggagggcaggatgacaattcccagactgttacaaaggccacagcgagcaatgtgcaagtgtggactgtatgcagaaaagaggtaataaataattttatgtgaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MELDNLGDGEDAHMLNGSVSESLNTERLNMEDGDEAEEAALEEREKFLSHVVPQKSNFTDFEGKTSFGMSVFNLSNAIMGSGILGLAYAMSNTGIILFVFLLISIALLSCYSIHLLLKCSGVVGIRAYEQLGLRAFGTAGKILAAVIITMHNVGAMSSYLYIIKYELPLVIQTFMGLTSNSGAWYMNGNYLIVIVSILVILPLALMKHLGYLGYTSGFSLTCMVFFLCSVIYKYSVIPCPLNSTVAENHTIYTNGQKLEEEDVCTAKLLTVNSQTAYSIPIVAFAFVCHPEVLPIYTELRRASKSRMQNVANVSIFAMFIMYLLTAIFGYLTFYGNVESEMLHTYNKVDPLDKLMLCVRLAVLVAVTLTVPVVLFPIRRAIQQLLCPGQEFKWWRHILIAVVLLIAVNILVIFVPNIKDIFGVIGATSAPSLIFILPSIFYIRIVPNEKEPLRSRPKIQAALFASLGFIFMIMSLSFIIVDWVTTGKSNVGGH
Donor tissue: tailbud