ORFeome > slc7a8 – XORFeome 2.0

slc7a8 – XORFeome 2.0

General Information

Species: Xenopus tropicalis solute carrier family 7 (cationic amino acid transporter, y+ system), member 8, mRNA (cDNA clone MGC:75862 IMAGE:5382875), complete cds
Gene Symbol: slc7a8
Gene ID: 394580
ORF gb_acc: MG133048
ORF ID: 10450

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC061338

Library Location

Plate ID: GDExt11004
Well Location: F12

EST Sequences

Clone: MGC:75862 IMAGE:5382875
Trimmed Sequence: ATGGCGGAAGGTGCAAGATTGCGCACCAGTGCTGAGAAGATCCCAGAGGAAAAGGGACAGGACTCTGGCTCAGGTTCAAGCTCTGGGGAAGATGGTGGTGTGGCTCTGAAGAAAGAGATTGGGTTGGTGAGCGCCTGTGGCATTATAGTAGGTAATATTATTGGTTCTGGTATATTTGTATCGCCAAAGGGAGTGCTGGAGAATGCAGGTTCTGTGGGAATGGCACTCATTGTATGGATTGTCACAGGGGTAATCACTGCAGTAGGAGCCCTTTGCTATGCAGAACTAGGGGTCACCATCCCAAAATCTGGAGGAGACTATTCATACGTTAAAGATATATTTGGTGGATTAGCAGGGTTCCTCCGACTGTGGATAGCAGTTCTGGTAATATATCCTACAAATCAAGCCGTTATTGCCCTGACATTCTCCAATTACGTCCTGCAGCCCCTCTTTCCTACATGCTTTGCACCAGAGTCTGGACTTCGATTGTTGGCTGCAGTCTGTCTATTGTTGCTGACATGGGTGAACTGCGCCAGTGTGCGCTGGGCAACTCGCGTGCAGGACATATTTACAGCTGGAAAACTTTTAGCCCTGGGACTTATCATTATTATGGGAATTGTGCAGATCTGCAAAGGAGAGTATTTCTGGCTGGAGCCAAAGAACGCCTTTGAGAATTTCCAGGAGCCAGACATTGGTCTGATTGCACTGGCCTTCTTGCAGGGATCCTTCGCTTACGGTGGCTGGAATTTCCTCAACTATGTCACAGAAGAACTGGTGAACCCCTACAAGAACTTGCCCCGTGCCATCTTTATCTCTATTCCACTTGTTACCTTTGTGTACGTATTTGCCAACATTGCCTATGTGACTGCCATGTCACCCCAGGAATTACTGGCATCCAACGCTGTGGCTGTGACATTTGGTGAAAAGTTGCTAGGTGTTATGGCCTGGATCATGCCAATTTCTGTGGCTCTCTCCACTTTTGGGGGAGTCAATGGATCTCTCTTTACTTCATCCAGGTTGTTTTTTGCGGGAGCCAGAGAGGGCCATCTCCCAAGTGTATTGGCAATGATTCACATCAAACGTTGCACTCCTATTCCAGCCCTGCTCTTTACTTGCATCTCCACTCTTCTGATGTTAGTGACCAGTGATATGTACACTCTTATCAATTACGTGGGCTTCATCAATTACCTGTTTTATGGAGTAACAGTGGCAGGACAGATTGTCCTACGATGGAAGAAGCCAGACATTCCACGACCTATTAAGGTGAACCTGATTTTCCCAGTGATCTACCTCCTATTTTGGGCCTTCCTACTAGTTTTCAGCTTATGGTCAGAGCCTGTGGTCTGTGGAATTGGCCTTGCAATCATGCTGACTGGGGTGCCTGTCTATTTCTTGGGAGTGCATTGGCAGAACAAGCCTCAGTGCTTTAATAATTTTGTGGATGCCATGACACGTGCCGGTCAAAAGCTATGTGTGGTTGTGTATCCCCAAATGGACAATAAAGATGAAGATGTGAGTGAAGAGACCAAAGAGCAGAGGGCGCCAATCTATAAACCAGGGTCTGAGGAAGAAAGTGGAGCACAAGCCTGA
Full Trace Sequence: ctgggtggtggtgtgatcaggtgcgcagaacagataaacaggctgtgtgggagataagaaaacacacacatatagaggaactggccatagcactgccctgacacacacaccagccttttcctgctggacaagagatgcactaaagctgccactagtcacacaggagatgcggagacaatcctgaaagaggacgcagaacaccggatcgggtgttggaagcaagggtgtttatagcagtttatttcccattgtctgctatattgtctttgggtcgtaaagatggcggaaggtgcaagattgcgcaccagtgctgagaagatcccagaggaaaagggacaggactctggctcaggttcaagctctggggaagatggtggtgtggctctgaagaaagagattgggttggtgagcgcctgtggcattatagtaggtaatattattggttctggtatatttgtatcgccaaagggagtgctggagaatgcaggttctgtgggaatggcactcattgtatggattgtcacaggggtaatcactgcagtaggagccctttgctatgcagaactaggggtcaccatcccaaaatctggaggagactattcatacgttaaagatatatttggtggattagcagggttcctccgactgtggatagcagttctggtaatatatcctacaaatcaagccgttattgccctgacattctccaattacgtcctgcagcccctctttcctacatgctttgcaccagagtctggacttcgattgttggctgcagtctgtctattgttgctgacatgggtgaactgcgccagtgtgcgctgggcaactcgcgtgcaggacatatttacagctggaaaacttttagccctgggacttatcattattatgggaattgtgcagatctgcaaaggagagtatttctggctggagccaaagaacgcctttgagaatttccaggagccagacattggtctgattgcactggccttcttgcagggatccttcgcttacggtggctggaatttcctcaactatgtcacagaagaactggtgaacccctacaagaacttgccccgtgccatctttatctctattccacttgttacctttgtgtacgtatttgccaacattgcctatgtgactgccatgtcaccccaggaattactggcatccaacgctgtggctgtgacatttggtgaaaagttgctaggtgttatggcctggatcatgccaatttctgtggctctctccacttttgggggagtcaatggatctctctttacttcatccaggttgttttttgcgggagccagagagggccatctcccaagtgtattggcaatgattcacatcaaacgttgcactcctattccagccctgctctttacttgcatctccactcttctgatgttagtgaccagtgatatgtacactcttatcaattacgtgggcttcatcaattacctgttttatggagtaacagtggcaggacagattgtcctacgatggaagaagccagacattccacgacctattaaggtgaacctgattttcccagtgatctacctcctattttgggccttcctactagttttcagcttatggtcagagcctgtggtctgtggaattggccttgcaatcatgctgactggggtgcctgtctatttcttgggagtgcattggcagaacaagcctcagtgctttaataattttgtggatgccatgacacgtgccggtcaaaagctatgtgtggttgtgtatccccaaatggacaataaagatgaagatgtgagtgaagagaccaaagagcagagggcgccaatctataaaccagggtctgaggaagaaagtggagcacaagcctgaactctgagcattcagccatctcccttgacccccatatacccgctgtcaagacctcagtgtacagatctgcagtgatggaaggaacttgcgtgaatgtgtttatgtgcatatgacaatgtgtgtctgtgtgggtacccctgtgtgcctctttgtgttactttccagtactggttattgcaccatcgtcctaaatataccatctgccctaatttgggggccccctgggacaggtaatataatttgaagttgtaggtgtataattgtccctgtcagttacatgtgcagttttgtctgtgctttgtactgttggactttgtatgtcaaccactccttgcgatgccataattagcagtatgtgctgtcttggaaggaagaaagctaagtaacagcagttctgctcagcattgtggaatattgtctgtgtactttgtgaacgtgcagatttgaggtcttggcttgcagtatttgtattttccttttgcccacccatcccaatattggcaacatgttgctccttgagggttacaaatcatttgaaatgtaaaagactgaagaatctatggaacttttttttgttatttgaacattggcagatcctatatttcacaaatcatggattgtgtatcatttggctgctccacactgcctgttaaaccatctccaatacagactgtgctgctggagctgggttatcaacggacaatcatgtaacgtgtacaggacaaacatgcttctcttgctgaagatttcctgtgaaagcaacaggaagtgaaaaagtgtgacgccagtacaccctagtgtagtctcaggtctctctttaccaatcaaatactttaccccacctccttacctgactgacccaggttacttcagggtattctcagtcctgcctccaatccaaagttgcgattaactgtaatgttgtgggaccctccagtcccttagtaccgaattaacacactccagaaattctgggtaattaccaggatgctctacatgttttatatgatatatatattttttatttaggattttgtctttgaatgtaataaaattaatcttgtgcctttttggtgaaacatcaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MAEGARLRTSAEKIPEEKGQDSGSGSSSGEDGGVALKKEIGLVSACGIIVGNIIGSGIFVSPKGVLENAGSVGMALIVWIVTGVITAVGALCYAELGVTIPKSGGDYSYVKDIFGGLAGFLRLWIAVLVIYPTNQAVIALTFSNYVLQPLFPTCFAPESGLRLLAAVCLLLLTWVNCASVRWATRVQDIFTAGKLLALGLIIIMGIVQICKGEYFWLEPKNAFENFQEPDIGLIALAFLQGSFAYGGWNFLNYVTEELVNPYKNLPRAIFISIPLVTFVYVFANIAYVTAMSPQELLASNAVAVTFGEKLLGVMAWIMPISVALSTFGGVNGSLFTSSRLFFAGAREGHLPSVLAMIHIKRCTPIPALLFTCISTLLMLVTSDMYTLINYVGFINYLFYGVTVAGQIVLRWKKPDIPRPIKVNLIFPVIYLLFWAFLLVFSLWSEPVVCGIGLAIMLTGVPVYFLGVHWQNKPQCFNNFVDAMTRAGQKLCVVVYPQMDNKDEDVSEETKEQRAPIYKPGSEEESGAQA
Donor tissue: neurula