ORFeome > smarcb1 – XORFeome 2.0

smarcb1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1, mRNA (cDNA clone MGC:79836 IMAGE:6987293), complete cds
Gene Symbol: smarcb1
Gene ID: 448543
ORF gb_acc: MG133752
ORF ID: 11321

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC076714

Library Location

Plate ID: GDExt11013
Well Location: A07

EST Sequences

Clone: MGC:79836 IMAGE:6987293
Trimmed Sequence: ATGATCATGGCGTTAAGTAAAACGTTTGGCCAAAAGCCAGTGAAATTTCAATTGGAAGAGGATGGAGAATACTACATGATAGGATCCGAGGTGGGAAATTACTTGCGCATGTTCAGGGGATCATTATATAAACGGTACCCTTCCCTTTGGAGACGGTTGGCAACAGTAGAAGAGAGGAAGAAAATAGTAGCGTCTTCTCATGGAAAGAAATATCATGGATATACCACTTTAGCTACCAGTGTTACTCTCTTAAAAGCTTCAGAAGTTGAAGAGATCCTTGATGGGAATGATGAGAAATATAAAGCAGTCTCTATTAGCACAGAACCACCAACCTACCTCAGGGAGCAAAAGGCAAAGCGAAATAGCCAGTGGGTTCCAACTCTACCCAACAGCTCCCACCACCTGGATGCAGTGCCTTGCTCTACTACTATAAACAGGAATCGTATGGGCCGAGACAAGAAAAGGACATTTCCACTGTGCTTTGATGACCATGATCCAGCAGTCATTCATGAAAATGCTGCTCAGTCAGAAGTCCTGGTTCCCATTCGATTAGACATGGAAATTGATGGGCAGAAGCTTCGAGATGCCTTTACGTGGAACATGAATGAGAAGTTGATGACTCCAGAAATGTTTGCTGAAATTCTCTGTGATGACCTTGACTTAAATCCTCTGGCTTTTGTTCCTGCCATTGCTTCGGCTATCCGCCAGCAAATAGAATCATATCCAACTGACAGCATCCTGGAAGATCAATCTGACCAGAGGGTCATCATCAAGCTCAATATCCATGTTGGAAACATTTCTTTGGTAGACCAGTTTGAGTGGGACATGTCCGAAAAGGAAAATTCCCCAGAAAAATTTGCTCTAAAGTTATGCTCAGAACTTGGACTTGGTGGGGAGTTTGTTACTACTATTGCTTACAGTATTCGAGGGCAGCTCAGCTGGCATCAGAAGACATATGCATTCAGTGAAAACCCACTGCCGACAGTAGAGATTGCTATTCGAAATACAGGCGATGCTGACCAGTGGTGCCCCCTCCTGGAGACCCTCACTGATGCCGAAATGGAGAAGAAGATCCGGGACCAGGACCGGAACACCAGGCGTATGAGACGTCTTGCCAACACTGCACCGGCTTGGTAA
Full Trace Sequence: ggatgatcatggcgttaagtaaaacgtttggccaaaagccagtgaaatttcaattggaagaggatggagaatactacatgataggatccgaggtgggaaattacttgcgcatgttcaggggatcattatataaacggtacccttccctttggagacggttggcaacagtagaagagaggaagaaaatagtagcgtcttctcatggaaagaaatatcatggatataccactttagctaccagtgttactctcttaaaagcttcagaagttgaagagatccttgatgggaatgatgagaaatataaagcagtctctattagcacagaaccaccaacctacctcagggagcaaaaggcaaagcgaaatagccagtgggttccaactctacccaacagctcccaccacctggatgcagtgccttgctctactactataaacaggaatcgtatgggccgagacaagaaaaggacatttccactgtgctttgatgaccatgatccagcagtcattcatgaaaatgctgctcagtcagaagtcctggttcccattcgattagacatggaaattgatgggcagaagcttcgagatgcctttacgtggaacatgaatgagaagttgatgactccagaaatgtttgctgaaattctctgtgatgaccttgacttaaatcctctggcttttgttcctgccattgcttcggctatccgccagcaaatagaatcatatccaactgacagcatcctggaagatcaatctgaccagagggtcatcatcaagctcaatatccatgttggaaacatttctttggtagaccagtttgagtgggacatgtccgaaaaggaaaattccccagaaaaatttgctctaaagttatgctcagaacttggacttggtggggagtttgttactactattgcttacagtattcgagggcagctcagctggcatcagaagacatatgcattcagtgaaaacccactgccgacagtagagattgctattcgaaatacaggcgatgctgaccagtggtgccccctcctggagaccctcactgatgccgaaatggagaagaagatccgggaccaggaccggaacaccaggcgtatgagacgtcttgccaacactgcaccggcttggtaaacagccccctcccgacgaaactcacggttcacatcctggagatggaacccctccccataaatgacacaatgtaacgattctaaataaacaaaagtaaaatttctaggattaaacattttgaaggagtggacggtggtcccagcacctcctgagtccatatcagagggagcgggtcacccaaacattccacattctaagcagcagggtgctgctgagtttggctccttcacacccctccttccatgtacagagagtgacgcattagtgctacctgactaccggaagacctgagacagatgtcccaagccctcctttatacctgtgaacgtgatctgtaaagctttttgtgttttatttttattttgtataggtgcctaatgcacttgtagaaacaaaaacaaaaaaaaaaaaatttttaaataaaagtaatgctcattattctgtaaaaaaaaaaaaaaaaaaa
Translation: MIMALSKTFGQKPVKFQLEEDGEYYMIGSEVGNYLRMFRGSLYKRYPSLWRRLATVEERKKIVASSHGKKYHGYTTLATSVTLLKASEVEEILDGNDEKYKAVSISTEPPTYLREQKAKRNSQWVPTLPNSSHHLDAVPCSTTINRNRMGRDKKRTFPLCFDDHDPAVIHENAAQSEVLVPIRLDMEIDGQKLRDAFTWNMNEKLMTPEMFAEILCDDLDLNPLAFVPAIASAIRQQIESYPTDSILEDQSDQRVIIKLNIHVGNISLVDQFEWDMSEKENSPEKFALKLCSELGLGGEFVTTIAYSIRGQLSWHQKTYAFSENPLPTVEIAIRNTGDADQWCPLLETLTDAEMEKKIRDQDRNTRRMRRLANTAPAW
Donor tissue: gastrula